View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_low_20 (Length: 256)
Name: NF10036_low_20
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10036_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 12 - 136
Target Start/End: Original strand, 283953 - 284077
Alignment:
| Q |
12 |
tgttgaacattggaaacacggaagtgtggtacaaagatggtcaatatacatagatacatacctctagcatgtaggtgactgtctcaaaacctgcaaaaga |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
283953 |
tgttgaacatcggaaacacggaagtgtggtacaaagatggtcaatatacatagatacatacctctagcatgtaggtgactgtctcaaaacctgcaaaaga |
284052 |
T |
 |
| Q |
112 |
gatatgcaaatcaagatattattag |
136 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
284053 |
gatatgcaaatcaagatattattag |
284077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 242
Target Start/End: Original strand, 284141 - 284183
Alignment:
| Q |
200 |
cctctgtgtggatgatcaggaaatcctccaggaggagatactg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
284141 |
cctctgtgtggatgatcaggaaatcctccaggaggagatactg |
284183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University