View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_low_21 (Length: 255)
Name: NF10036_low_21
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10036_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 56182472 - 56182603
Alignment:
| Q |
18 |
tggtaagttaattatagccttccttttttgacttcccactcctcaaccctattaattaataaataaataaattaaaagcttaaagcttatttttcttttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
56182472 |
tggtaagttaattatagccttccttttttgacttcccactcctcaaccctattaattaata----aataaattaaaagcttaaagcttatttttcttttt |
56182567 |
T |
 |
| Q |
118 |
ctataaagatgaatatcacttttggcagaggatatg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
56182568 |
ctataaagatgaatatcacttttggcagtggatatg |
56182603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University