View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_low_23 (Length: 250)
Name: NF10036_low_23
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10036_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 9086677 - 9086918
Alignment:
| Q |
1 |
aaccccaatataattgaacctgcaatatcatattaaaagttagaattttcttcccaacaaaaagagataaacagaacattaagaaacaaaaattagtttc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9086677 |
aaccccaatataattgaccctgcaatatcatattaaaagttagaattttcttcccaacaaaaacagataaacagaacattaagaaacaaaaagtagtttc |
9086776 |
T |
 |
| Q |
101 |
ttaatttcgtctcatcttaccggtactagcaaaaataagagagcttggaatatagatagttttctgtattcttttgcgtttaaaacattcaatgtcacgt |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9086777 |
ttagtttcgtctcatcttaccggtactagcaaaaataagagagtttggaatatagatagttttccgtattcttttgcggttaaaacattcaatgtcacgt |
9086876 |
T |
 |
| Q |
201 |
ttggagctgttggtgttccatctacatttcatgccctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9086877 |
ttggagctgttggtgttccatctacatttcatgccttttgct |
9086918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 9126005 - 9126057
Alignment:
| Q |
183 |
aaacattcaatgtcacgtttggagctgttggtgttccatctacatttcatgcc |
235 |
Q |
| |
|
|||||||||||||||| ||||| || |||| | |||||||||||||||||||| |
|
|
| T |
9126005 |
aaacattcaatgtcacatttggtgccgttgttattccatctacatttcatgcc |
9126057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University