View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_low_8 (Length: 428)
Name: NF10036_low_8
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10036_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 15 - 412
Target Start/End: Original strand, 20093713 - 20094109
Alignment:
Q |
15 |
gagagacatgaaacagccagcgcacaaggaggggcatcgttactttcactagttgatgagattgtagtacaattgtattgtatgagggcataatgtttgg |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
T |
20093713 |
gagagacatgaaacagccagcgcacaaggagggacatcattactttcactagttgatgagat-gtagtacaattgtattgtatgagggcatgttgtttgg |
20093811 |
T |
 |
Q |
115 |
atcatggaccccgtaaagttaattaatttgctttgctcgtggggcatgttctagcttcctcattatgaatcaacattcaaccttgcttatggtaaacgta |
214 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
20093812 |
atcatggaccctgtaaagttaattaatttgctttgctcgtggggcatgttctagcttcctcattatgaatcaacattgaaccttgcttatggtaaacgta |
20093911 |
T |
 |
Q |
215 |
agaattatttatatcacacttatgccaagtagtgtaataacaaagattacaagcacctaatttgcagttatgctctccactttgcaagtatgtaaaagca |
314 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
20093912 |
agaattatttatatcacaattatgccaagtagtgtaataacaaagattacaagcacctaatttgcagttatgctctccactttgcaaatatgtaaaagca |
20094011 |
T |
 |
Q |
315 |
attggaactnnnnnnnttgtgataaggtcgcaacttacacaaataaagatatcgggtgcaacatttacataataatatgaaaatgagatatataatat |
412 |
Q |
|
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
20094012 |
attggaactaaaaaaattgtgataaggttgcaacttacacaaataaagatatcgggtgcaacatttacataataatatgaaaatgggatatataatat |
20094109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University