View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10037_low_4 (Length: 250)
Name: NF10037_low_4
Description: NF10037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10037_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 30953407 - 30953640
Alignment:
| Q |
1 |
tagattgtcgatctaatcttcagtaattttaagttggtgtaaattagcagtcttagatacacacattcacacacatgagatctctagcgctcgcaaagta |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953407 |
tagattgtcaatctaatcttcagtaattttatgttggtgtaaattagcagtcttagatacacatattcacacacatgagatctctagcgctcgcaaagta |
30953506 |
T |
|
| Q |
101 |
gaaatcatatctttcttgtaggttctcttgcacaaacaagaaaaagtgagact--cacacaaatacaaaatcagctattgagtgagagaataagagaggg |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953507 |
gaaatcatatctctcttgtaggttctcttacacaaacaagaaaaagtgcgactcacacacaaatacaaaatcagctattgagtgagagaataagagaggg |
30953606 |
T |
|
| Q |
199 |
gattaggacaccacgacatatctaatgttaaaggt |
233 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| |
|
|
| T |
30953607 |
gatt-ggacaccacgacacatctaatgttaaaggt |
30953640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University