View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_high_12 (Length: 250)
Name: NF10038_high_12
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 35581312 - 35581121
Alignment:
| Q |
1 |
cacttagattggccaaactcagtacttcttttggccatgtgcaaattatatattcctatcaggtgattcttttcattctttttgtttgattataaatgtg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35581312 |
cacttagattggccaaactcaatacttcttctggccatgtacaaattatatattccttccaggtgattctttttattctttttgtttgattataaatgtg |
35581213 |
T |
 |
| Q |
101 |
tggttctgatcctctcctatttagatgggttttatccaatttcttgattgtgagagctgtacctacatgttcaagttaaatgatgactacct |
192 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35581212 |
tgattctgatcctctcctgtttagatgggttttatccaatttcttgattgtgagagttgtacctacatgttcaagttaaatgatgactacct |
35581121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 239
Target Start/End: Complemental strand, 35580662 - 35580634
Alignment:
| Q |
211 |
ctgctttatcacatcaaccccgtgtctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35580662 |
ctgctttatcacatcaaccccgtgtctct |
35580634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University