View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_high_16 (Length: 240)
Name: NF10038_high_16
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10038_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 6497501 - 6497293
Alignment:
Q |
1 |
cgtgaaatactatatatctaggcttcatagaactccagtaacagatatcagaaatgcaaacagaattattaattatgcacaataaaagtaatgtaaaaac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6497501 |
cgtgaaatactatatatctaggcttcatagaactccagtaacagatatcagaaatgcaaacagaattattaattatgcacaataaaagtaatgtaaaaac |
6497402 |
T |
 |
Q |
101 |
aagcttcatgtcttaatggcaggttgatatctctccctgagggatgagaggcaggggggctctgtgaatcaatcagttgtgcaacaaaacggataagctc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
T |
6497401 |
aagcttcatgtcttaatggcaggttgatatctctccctgagggatgagaggcaggggggctctgcgaatcaatcagttgtgcaacaaaacagataagctc |
6497302 |
T |
 |
Q |
201 |
aattcatgt |
209 |
Q |
|
|
||||||||| |
|
|
T |
6497301 |
aattcatgt |
6497293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University