View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_19 (Length: 315)
Name: NF10038_low_19
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 37876971 - 37876691
Alignment:
| Q |
19 |
gttatctaggggtaaacaatcacttaaagctatttatctatctgctagaacgggtggatttccaacacaagatcatgaaagggataaattcgagtctgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37876971 |
gttatctaggggtaaacaatcacttaaagctatttatctatctgctagaacgggtggatttccaacacaagatcatgaaagggataaatttgagtctgat |
37876872 |
T |
|
| Q |
119 |
gggtgtggtctggagatgaaatgtattcaaccgtcgttgaaagaggttcctagtgtgcctttggttgttgatcatttgccggaattatccgaaccttcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37876871 |
gggtgtggtctggagatgaaatgtattcaaccgtctttgaaagaggttcctagtgtgcctttggttgttgatcatttgccggaattatcggaaccttcaa |
37876772 |
T |
|
| Q |
219 |
tgttgatttcgaatagtttgaggaatgtggtttatgatgcacttccggctttaattcataggaagaaatggttaatgatgt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37876771 |
tgttgatttcgaatagtttgaggaatgtggtttatgatgcacttccggctttaattcatgggaagaaatggttaatgatgt |
37876691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University