View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_21 (Length: 298)
Name: NF10038_low_21
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10038_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 294
Target Start/End: Complemental strand, 36866020 - 36865743
Alignment:
Q |
17 |
attaatcacaataactatagtgaaagggagagtgtaagtcacgttatgattaattgctaaccattgcccttaatttaaaaccctaagatcaaaacaaaat |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36866020 |
attaatcacaataactatagtgaaagggagagtgtaagtcacgttatgattaattgctaaccattgcccttaatttaaaaccctaagatcaaaacaaaat |
36865921 |
T |
 |
Q |
117 |
caaaggttatgatacttactaatgcagtaagcatatccttctcttttcctttattatcttccctctcttcatgcaccccttcagtttttcacggttacca |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
36865920 |
caaaggttatgatacttactaatgcagtaagcatatccttctcttttcctttattatcttccctctcttcttgcaccccttcagtttttcacggttacca |
36865821 |
T |
 |
Q |
217 |
attgctgccagcaacattggttttaatattttctcatgattccaatgtgtattgactgtgctatgcttcatctctctc |
294 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
36865820 |
attgctgccaccaacattggttttaatattttctcatgattccaatgtgtattgactgtgctgtgcttcctctctctc |
36865743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University