View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_23 (Length: 274)
Name: NF10038_low_23
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 36273444 - 36273191
Alignment:
| Q |
17 |
aattacgagttgcctaacgtcaaagctttctgaaacacacacccacatcttggataaaaaatactcatttattctctcattattgaacacaagctttgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36273444 |
aattacgagttgcctaacgtcaaagctttctgaaacacac--ccacatcttggataaaaaatactcatttattctctcatcattgaacacaagctttgca |
36273347 |
T |
 |
| Q |
117 |
agtgtagtctttcccacgccccgaaaccccacaatagggacaac--agaaattttgataattatcatgttgaatcaaatgctttatgatcttttctttat |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273346 |
agtgtagtctttcccacgctccgaaaccccacaatagggacaacagagagattttgataattatcatgttgaatcaaatgctttatgatcttttctttat |
36273247 |
T |
 |
| Q |
215 |
catgttcccttcctatcacatctaaattaatcacacgtgagtaattcatctctctc |
270 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36273246 |
catgttcccttcctatcacatctgaattaatcacacgtgagtaattcatctctctc |
36273191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 249
Target Start/End: Complemental strand, 49351866 - 49351816
Alignment:
| Q |
199 |
atgatcttttctttatcatgttcccttcctatcacatctaaattaatcaca |
249 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
49351866 |
atgattttttgtttatcatgttcccttcctatcacatcagaatcaatcaca |
49351816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University