View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_24 (Length: 268)
Name: NF10038_low_24
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 356408 - 356165
Alignment:
| Q |
14 |
caaaggcagagctagcaccaacctcaggaaaatcattggcagcaactgcattagccttgcttgcataatccaatgtcttagggtcaaaagttgaatcctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
356408 |
caaaggcagagctagcaccaacctcaggaaaatcattggcagcaaatgcattagccttgcttgcataatccaatgtcttagggtcaaaagttgaatcctt |
356309 |
T |
 |
| Q |
114 |
accagcatctaccgtagaacctctggccaaatcagtgtgattgatcttgttctgcgtgtggttcttaccagcaacgggccacaaactacctttggcagaa |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
356308 |
accagcatctaccatagaacctctggccaaatcagtgtgattgatcttgttctgcgtgtggttcttaccagcaacgggccacaaactacctttggcagaa |
356209 |
T |
 |
| Q |
214 |
gtattaacctgaatattaccctgtttcagcttagaagcattcat |
257 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
356208 |
gtattaacttgaatattaccctgtttcagcttagaagcattcat |
356165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 14 - 224
Target Start/End: Complemental strand, 10582453 - 10582244
Alignment:
| Q |
14 |
caaaggcagagctagcaccaacctcaggaaaatcattggcagcaactgcattagccttgcttgcataatccaatgtcttagggtcaaaagttgaatcctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
10582453 |
caaaggcagagctagcaccaacctcaggaaaataattggcagcaactacatcagccttgcttgcaaaatccagtgtctaagggtcaaaagttgaatcctt |
10582354 |
T |
 |
| Q |
114 |
accagcatctaccgtagaacctctggccaaatcagtgtgattgatcttgttctgcgtgtggttcttaccagcaacgggccacaaactacctttggcagaa |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10582353 |
accagcatctaccgttgaacctctggccaaatcagtgtgattgatcttgttctgcgtgtagtt-ttaccagcaacgggcctcaaactacctttggcagaa |
10582255 |
T |
 |
| Q |
214 |
gtattaacctg |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
10582254 |
gtattaacctg |
10582244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University