View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_27 (Length: 255)
Name: NF10038_low_27
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10038_low_27 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 255
Target Start/End: Complemental strand, 50264218 - 50263976
Alignment:
Q |
13 |
ttggtgttgctaccatgaatttcttgctatgctatcttcaaaagttggttgcttgattatgtcagttaactataggttagcaccagaaaatcctcttcca |
112 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50264218 |
ttggagttgctaccatgaatttcttgctatgctatctttaaaagttggttgcttgattatgtcagttaactataggttagcaccagaaaatcctcttcca |
50264119 |
T |
 |
Q |
113 |
gcaccttatgatgatggtttaaatgcactaatgtggttgaaaaaacaatttttatatcaaaatgagagtagtgaatttgaatggtggactacaaaatgca |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
50264118 |
gcaccttatgatgatggtttaaatgcactaatgtggttgaaaaaacaatttttatatcaaaatgagagtagtgaatttgaatggtggactaaaaaatgca |
50264019 |
T |
 |
Q |
213 |
acttttctaatgtcttcttaggaggtgatagtgcaggtggtaa |
255 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50264018 |
acttttctaatgtcttcttaggaggtgatagtgcaggtggtaa |
50263976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University