View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10038_low_28 (Length: 254)

Name: NF10038_low_28
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10038_low_28
NF10038_low_28
[»] chr3 (1 HSPs)
chr3 (18-245)||(49805118-49805343)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 49805343 - 49805118
Alignment:
18 agttgtttccggaaagagtaattttagagggagagtgtctaactatgagatttcactccttcnnnnnnnttatgagatttcacatcgaaagataaaagat 117  Q
    |||||||||| |||||||||||||||||| |||  |||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
49805343 agttgtttccagaaagagtaattttagagtgag--tgtctaactatgagatttcactccttcaaaaaaattatgagatttcacatcgaaagataaaagat 49805246  T
118 gtataaggctattaatcagtcnnnnnnnnttaactttggaaagtgtgaaagcatgccaaaaataaaaatannnnnnnctctttgtaaagagaaatattat 217  Q
    |||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||     
49805245 gtataaggctattaatcagtcaaaaaaaattaactttggaaagtgtgaaagcatgccaaaaataaaaatatttttttctctttgtaaagagaaatattac 49805146  T
218 ggtgacagcaaatttgtcgtcaaacacc 245  Q
    ||||||||||||||||||||||||||||    
49805145 ggtgacagcaaatttgtcgtcaaacacc 49805118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University