View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_28 (Length: 254)
Name: NF10038_low_28
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 49805343 - 49805118
Alignment:
| Q |
18 |
agttgtttccggaaagagtaattttagagggagagtgtctaactatgagatttcactccttcnnnnnnnttatgagatttcacatcgaaagataaaagat |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49805343 |
agttgtttccagaaagagtaattttagagtgag--tgtctaactatgagatttcactccttcaaaaaaattatgagatttcacatcgaaagataaaagat |
49805246 |
T |
 |
| Q |
118 |
gtataaggctattaatcagtcnnnnnnnnttaactttggaaagtgtgaaagcatgccaaaaataaaaatannnnnnnctctttgtaaagagaaatattat |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49805245 |
gtataaggctattaatcagtcaaaaaaaattaactttggaaagtgtgaaagcatgccaaaaataaaaatatttttttctctttgtaaagagaaatattac |
49805146 |
T |
 |
| Q |
218 |
ggtgacagcaaatttgtcgtcaaacacc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
49805145 |
ggtgacagcaaatttgtcgtcaaacacc |
49805118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University