View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_33 (Length: 242)
Name: NF10038_low_33
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_33 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 242
Target Start/End: Complemental strand, 35581524 - 35581303
Alignment:
| Q |
21 |
atcctaggactgtgtgagcaaaagaagcttgatattgcgattcaagctctagacttgatggtaaaagctcaatgcaagccagatgagaaaatatattata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35581524 |
atcctaggactgtgtgagcaaaagaagcttgatagtgcgattcaagctctagacttgatggtaaaagctcaatgcaagccagatgggaaaatatattata |
35581425 |
T |
 |
| Q |
121 |
ctttacttaaatctgttgctaatgacggtatggtaaaagaggctaatgatttgcatcagaggttgatcgagttgaagattctaaaagacggacgtttgat |
220 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35581424 |
ctttacttaagtctgttgctaatgagggtatggtaaacgaggctaatgatttgcatcagaggttgatcgagttgaagattctaaaagacggatgtttgat |
35581325 |
T |
 |
| Q |
221 |
agtaggagctcacacttagatt |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35581324 |
agtaggagctcacacttagatt |
35581303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University