View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_35 (Length: 240)
Name: NF10038_low_35
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 34137957 - 34137724
Alignment:
| Q |
1 |
tgtaactaatgctaactaactacgttatatgagatatgattgcattaagtgagattactaccg-------ttactaatattattaatt-gttaatatttg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
34137957 |
tgtaactaatgctaactaactacgttatatgagatatgattgcattaagtgagattactaccgactaccgttactaatattattaatttgttaatatttg |
34137858 |
T |
|
| Q |
93 |
attaatttggtcaatgctcagttaatattcttttt-aggaagtaagtaataaaattagtttttgttcatatttttcacaataagcacgagagaaaagtca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34137857 |
attaatttggtcaatgctcagttaatattcttttttaggaagtaagtaataaaattagtttttgttcatatttttcacaataagcacgagagaaaagtca |
34137758 |
T |
|
| Q |
192 |
catatatgctctaaaactagtctagattcaatgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34137757 |
catatatgctctaaaactagtctagattcaatgt |
34137724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University