View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_38 (Length: 213)
Name: NF10038_low_38
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 113 - 203
Target Start/End: Original strand, 7035446 - 7035536
Alignment:
| Q |
113 |
gccaacatagtgaccatccattcataaatatcactgtagtataacatctttgacaaactcaccaaaacacattaactaagttcatctcact |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
7035446 |
gccaacatagtgaccatccattcataaatatcactgtagtataacatctttgacaaactcaccaaaacacattaaccaagttcaactcact |
7035536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 115 - 201
Target Start/End: Original strand, 7896681 - 7896767
Alignment:
| Q |
115 |
caacatagtgaccatccattcataaatatcactgtagtataacatctttgacaaactcaccaaaacacattaactaagttcatctca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
7896681 |
caacatagtgaccatccattcataaatatcactgtagtataacatctttgacaaactcacaaagacacattaactaagttcaactca |
7896767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 7035351 - 7035401
Alignment:
| Q |
19 |
aaacatcctaaaatctgcagatatatatacaagtcagagctaactagaatt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7035351 |
aaacatcctaaaatctgcagatatatatacaagtcagagctaactagaatt |
7035401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 7896585 - 7896635
Alignment:
| Q |
19 |
aaacatcctaaaatctgcagatatatatacaagtcagagctaactagaatt |
69 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||| |||| |
|
|
| T |
7896585 |
aaacatcctaaaatttgcagatatatatacaagtcggagctaactataatt |
7896635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University