View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10038_low_9 (Length: 410)
Name: NF10038_low_9
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10038_low_9 |
 |  |
|
| [»] scaffold0354 (1 HSPs) |
 |  |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 338; Significance: 0; HSPs: 51)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 18 - 400
Target Start/End: Original strand, 11144533 - 11144915
Alignment:
| Q |
18 |
attttgatcagtgatttatgatctttttgattaatttatcaagctttaaatttagatcatcgaatttcagtcaaacagtctctaaaacattgactgaatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
11144533 |
attttgatcagtgatttatgatctttttgattaatttatcaagctttaaatttagatcatcgaatttcaatcaaacagtctctaaaacattgactgcatg |
11144632 |
T |
 |
| Q |
118 |
actgaaggaggcacnnnnnnnggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
11144633 |
actgaaggaggcactttttttggtggtgtccggggttcaaaccccagaccttgcatatattatgcattgtctttatcaactgaggtaagttcatgaggac |
11144732 |
T |
 |
| Q |
218 |
gactgaaggaggcactagtacaattgcgtattttaataatattgtcttttatattctttaatgtacaacatggtacaccaattattgctcaaaattaaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11144733 |
gactgaaggaggcactagtacaattgtgtattttaataatattgtcttttatattctttaatgtacaacatggtacaccaattattgctcaaaattaaat |
11144832 |
T |
 |
| Q |
318 |
tggtatactaagctcatttttgttgtctgacttttgcctgcagttcaatctttgtttgatacaatatttgctgaagatctgtg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11144833 |
tggtatactaagctcatttttgttgtctgacttttgcctgcagttcaatctttgtttgatacaatatttgctgaagatctgtg |
11144915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 56497597 - 56497664
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||| ||||||||||| ||| |||||||| |||| |
|
|
| T |
56497597 |
ggtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccttaccaattgagctaag |
56497664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 7371539 - 7371604
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| |||| |||||| ||||||| |||| |||| |
|
|
| T |
7371539 |
tggtgtccggggttcgaaccccggaccttgcatatattatgtattgtccttatcaactgagttaag |
7371604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 43182983 - 43183044
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||| |||| |||||||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
43182983 |
gtggtatccgtggttcaaaccttagaccttgcatatattatgcattgtctttatcaactgag |
43183044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 47806245 - 47806294
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
47806245 |
ggtggtgttcggggttcgaaccccagaccttgcatatattatgcattgtc |
47806294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 206
Target Start/End: Complemental strand, 18635599 - 18635535
Alignment:
| Q |
142 |
ggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
18635599 |
ggtgtctgggattcaaaccccagaccttgtatatattatgcattgtccttatcaactgagttaag |
18635535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 217
Target Start/End: Complemental strand, 23628834 - 23628755
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatact-atgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||| | ||||||||||| |||||| |||| | ||||||||||||| |
|
|
| T |
23628834 |
ggtggtgtccggggttcgaaaccaggaccttgcatatatttatgcattgtctatatcaactgagttcagttcatgagaac |
23628755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 185
Target Start/End: Complemental strand, 3580786 - 3580740
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
3580786 |
ggtggtgtccggggttcgaatcccagaccttgcatatattatgcatt |
3580740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 51298686 - 51298756
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||| |||||| ||||||| |||| |||||||| |
|
|
| T |
51298686 |
gtggtgtccgggattcaaaccccgaaccttgcatatattatatattgtccttatcaactgagttaagttca |
51298756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 56564973 - 56565039
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
56564973 |
gtggtgttcggggttcgaaccctagaccttgcatattttatgcattgtccatatcaattgagctaag |
56565039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 164 - 217
Target Start/End: Original strand, 4485847 - 4485900
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |||||||| |||||| |
|
|
| T |
4485847 |
gaccttgcatatactatgtattgtccttatcaattgaactaagttcacgagaac |
4485900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 12439726 - 12439662
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatga |
213 |
Q |
| |
|
||||||||||| || | |||||||||||| ||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
12439726 |
cggggttcaaatccga-accttgcatatattatgcattgtccttatcaactgagctaagttcatga |
12439662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 14542749 - 14542798
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||| | |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
14542749 |
ggtggtgttcagggttcgaaccccagaccttgcatatattatgcattgtc |
14542798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 144 - 201
Target Start/End: Original strand, 24785456 - 24785513
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||||||||| ||| ||| |||| |
|
|
| T |
24785456 |
tgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgag |
24785513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 144 - 201
Target Start/End: Complemental strand, 24822810 - 24822753
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||||||||| ||| ||| |||| |
|
|
| T |
24822810 |
tgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgag |
24822753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 46676487 - 46676560
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatg |
212 |
Q |
| |
|
||||||||| |||| || |||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| ||||| |
|
|
| T |
46676487 |
ggtggtgtctgggggtcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcatg |
46676560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 217
Target Start/End: Complemental strand, 9473997 - 9473945
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||||||| | || |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
9473997 |
accttgcatatgcaatacattgtttttatcaattgagctaagttcatgagaac |
9473945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 192
Target Start/End: Complemental strand, 10006411 - 10006359
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10006411 |
gtggtggccggtattcgaaccccagaccttgcatatattatgcattgtcttta |
10006359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 206
Target Start/End: Original strand, 19124622 - 19124678
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||| |||||||||||||| |||| |||| |
|
|
| T |
19124622 |
gggttcgaacctcagaccttgcatatattatgtattgtctttatcaactgagttaag |
19124678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 23247588 - 23247636
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
23247588 |
gtggtggccggggtttaaaccccagaccttgcatatattatgcgttgtc |
23247636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 29808258 - 29808314
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
29808258 |
gtggtgtccaaggttcgaaccccataccttgcatatattatgcattgtccttatcaa |
29808314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 49041971 - 49042027
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||| |||||||||||| |||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtctatatcaa |
49042027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 206
Target Start/End: Complemental strand, 49308881 - 49308825
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| || |||| |||| |||| |
|
|
| T |
49308881 |
gggttcgaaccccagaccttgcatatattatgcattgtccttgtcaactgagctaag |
49308825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 3936698 - 3936651
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 143 - 206
Target Start/End: Complemental strand, 6474507 - 6474444
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| |||||||||| || |||| |||| |||| |
|
|
| T |
6474507 |
gtgtccggggttcgaaccccagaccttgcttatatgatgcattgtccttgtcaactgagctaag |
6474444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 27655801 - 27655732
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||||||||| |||||||||| | |||||| ||| |||||||| |
|
|
| T |
27655801 |
gtggtggccggggttcgaaccc-agaccttgcatatattatgcattgtttctatcaactgaactaagttca |
27655732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 217
Target Start/End: Complemental strand, 32139411 - 32139333
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| |||| |||||| |||||| |||| |||| ||| |||||| |
|
|
| T |
32139411 |
gtggtgtccggggttcgaaccccggaccttgcatatatttatgtattgtccctatcaactgagctaagctcacgagaac |
32139333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 189
Target Start/End: Original strand, 34833995 - 34834045
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtct |
189 |
Q |
| |
|
|||||||||| | |||| |||||| ||||||||||||| |||||||||||| |
|
|
| T |
34833995 |
ggtggtgtccagtgttcgaaccccggaccttgcatatattatgcattgtct |
34834045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 38297993 - 38297947
Alignment:
| Q |
160 |
cccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
38297993 |
cccagaccctgcatatattatgcattgtccatatcaattgaggtaag |
38297947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 185
Target Start/End: Original strand, 54294411 - 54294457
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
54294411 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 6789433 - 6789482
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||| ||| |||| |||| |
|
|
| T |
6789433 |
aaccccggaccttgcatatactatgcattgtccttaccaactgagctaag |
6789482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 11269766 - 11269717
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||||| |||| |||||| |
|
|
| T |
11269766 |
ggtggtgtctggggttcgaacccaagaccttgcatatattatgtattgtc |
11269717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 218
Target Start/End: Complemental strand, 17134179 - 17134118
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaacg |
218 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| || |||||||| |||| ||| ||||||| |
|
|
| T |
17134179 |
aaccccagaccttatatatattatgcattgtctctaccaattgagttaagctcacgagaacg |
17134118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 21266889 - 21266938
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||| ||||| |||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
21266889 |
aaccccaaaccttacatatattatgcattgtctttaacaattgagctaag |
21266938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 42756121 - 42756166
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| |||| |||||||| |
|
|
| T |
42756121 |
accttgcatatattatgcattgtccttatcaactgagctaagttca |
42756166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 43034331 - 43034380
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
43034331 |
ggtggtggccggggtttgaacctcagaccttgcatatattatgcattgtc |
43034380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 48226505 - 48226558
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||| |||||||| |
|
|
| T |
48226505 |
aaccccagaccttgcatattttatgcattgtccataccaattgagctaagttca |
48226558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 52132299 - 52132340
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
52132299 |
ccggggttcgaaccacagaccttgcatatattatgcattgtc |
52132340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 11166757 - 11166709
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||| ||||||| |
|
|
| T |
11166757 |
gtggtgtccggggttcgaaccttagaccttgcatatattatacattgtc |
11166709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 19854636 - 19854588
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||| ||||| |||||| || |||||||||| ||||||||||| |
|
|
| T |
19854636 |
gtggtgtccgaggttcgaaccccggatcttgcatatattatgcattgtc |
19854588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 26008063 - 26008099
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattga |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
26008063 |
gaccttgcatatattatgcattgtctttaccaattga |
26008099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 29910510 - 29910466
Alignment:
| Q |
162 |
cagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
29910510 |
cagatcttgcatatattatgcattgtccttatcaattgagttaag |
29910466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 37800894 - 37800854
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
37800894 |
cggggttcgaaccccagacctcgcatatattatgcattgtc |
37800854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 38375028 - 38374980
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtc |
38374980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 39974573 - 39974525
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
39974573 |
gtggtgtccgaggtttgaaccccagaccttccatatattatgcattgtc |
39974525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 40849726 - 40849690
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatata |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40849726 |
gtggtgtccggggttcaaacccgcgaccttgcatata |
40849690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 43782312 - 43782372
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| ||| ||| |||| |||||| | |||||| |
|
|
| T |
43782312 |
aaccgcagaccttgcatatattatgcattgtcattaccaactgagctaagtttacgagaac |
43782372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 49473716 - 49473668
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| | ||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
49473716 |
gtggtgactggggttcgaaccccggaccttgcatatattatgcattgtc |
49473668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 207
Target Start/End: Complemental strand, 49949405 - 49949338
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagt |
207 |
Q |
| |
|
||||||| ||||| ||| ||||| |||||||||||||| ||||||||||| ||| ||| |||| ||||| |
|
|
| T |
49949405 |
ggtggtggccgggattcgaaccc-agaccttgcatatattatgcattgtccttaccaactgagctaagt |
49949338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 49952685 - 49952721
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattga |
200 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
49952685 |
gaccttgcatatattatgcattgtccttatcaattga |
49952721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 52620637 - 52620569
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
52620637 |
ggtggtgtccggagttcgaacccgcgaccttgcatatatttatgcattgtctatatcaactgagctaag |
52620569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 29)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 9055395 - 9055468
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatga |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||| |||| | |||||||| |||| ||||||||||| |
|
|
| T |
9055395 |
gtggtgtccgaggttcaaaccccagaccttgcatatattatacattatttttatcaactgagctaagttcatga |
9055468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 1244695 - 1244765
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||| ||| ||| |||| |||||||| |
|
|
| T |
1244695 |
gtggtgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgagctaagttca |
1244765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 444484 - 444418
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||| ||||||||||| ||| |||||||| |||| |
|
|
| T |
444484 |
gtggtggccggggtttaaaccccggaccttgcatatattatgcattgtccttaccaattgagctaag |
444418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 192
Target Start/End: Original strand, 9019553 - 9019606
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9019553 |
ggtggtgtttggggttcaaacccaagaccttgcatatattatgcattgtcttta |
9019606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 143 - 206
Target Start/End: Complemental strand, 30623361 - 30623298
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
30623361 |
gtgttcggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaag |
30623298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 498802 - 498754
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
498802 |
gtggtgtccgaggtttaaaccacagaccttgcatatattatgcattgtc |
498754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 6439055 - 6438999
Alignment:
| Q |
152 |
gttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
|||| ||||||||||||| |||||| |||| ||| ||||||||||||||| |||||| |
|
|
| T |
6439055 |
gttcgaaccccagaccttacatatattatgtattatctttatcaattgagataagtt |
6438999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 11053039 - 11052999
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
11053039 |
cggggttcaaaccccggaccttgcatatattatgcattgtc |
11052999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 36059350 - 36059418
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatact-atgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| | ||||||||||| |||||| |||| |||| |
|
|
| T |
36059350 |
ggtggtgtccggggttcgaaccctcgaccttgcatatattgatgcattgtctatatcaactgagctaag |
36059418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 38763505 - 38763553
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| || |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
38763505 |
gtggtggccagggttcgaaccccagaccttgcatatattatgcattgtc |
38763553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 34997530 - 34997463
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
34997530 |
gtggtgtccggggttcgaacccatgaccttgcatatatttatgcattgtctatatcaactgagctaag |
34997463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 144 - 206
Target Start/End: Original strand, 1877656 - 1877718
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||| ||| ||||| ||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
1877656 |
tgtccgggattcgaacccgtgaccttgcatatattatgcattgtctatatcaactgagttaag |
1877718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 37749990 - 37750036
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
37749990 |
tggtggccggggttcaaaccccggactttgcatatattatgcattgt |
37750036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 12748973 - 12748924
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
12748973 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
12748924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 15438511 - 15438458
Alignment:
| Q |
153 |
ttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
15438511 |
ttcaaaccccggaccttgcatatattatgcattgtccttaccaagtgagctaag |
15438458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 15529815 - 15529762
Alignment:
| Q |
153 |
ttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
15529815 |
ttcaaaccccggaccttgcatatattatgcattgtccttaccaagtgagctaag |
15529762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 19488371 - 19488310
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||| ||| | |||||||||||| ||||| ||||||||||| ||| ||| |||| |
|
|
| T |
19488371 |
gtggtgtccgggattcgagccccagaccttgtatatattatgcattgtccttaccaactgag |
19488310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 184
Target Start/End: Original strand, 30176408 - 30176453
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcat |
184 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
30176408 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 31832079 - 31832128
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||||||| || ||| ||| ||||||||| ||||||||||| |
|
|
| T |
31832079 |
ggtggtgtccggggttcgaaacccggacattgcatatattatgcattgtc |
31832128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 32051521 - 32051570
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
32051521 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
32051570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 210
Target Start/End: Original strand, 9014677 - 9014737
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||| ||| |||||||||||||||| |||| |||||| || |||||||| |||||||| |
|
|
| T |
9014677 |
gggttcgaactccagaccttgcatatattatgtattgtcgctaccaattgagctaagttca |
9014737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 141 - 192
Target Start/End: Original strand, 11963394 - 11963446
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccaga-ccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
|||||| | |||||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
11963394 |
tggtgttcagggttcgaacctcagaaccttgcatatactatgcattgtcttta |
11963446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 143 - 206
Target Start/End: Complemental strand, 15310391 - 15310327
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
15310391 |
gtgtccggggttcgaacgcaagaccttgcatatatttatgcattgtctatatcaactgagctaag |
15310327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 143 - 206
Target Start/End: Complemental strand, 15490760 - 15490696
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
15490760 |
gtgtccggggttcgaacgcaagaccttgcatatatttatgcattgtctatatcaactgagctaag |
15490696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 28440022 - 28439974
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||| ||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
28440022 |
cggggtttgaaccccagaccttacatatattatgcattatctttatcaa |
28439974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 187
Target Start/End: Original strand, 29924906 - 29924954
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
29924906 |
ggtggtgtctggggtttaaaccccgaaccttgcatatattatgcattgt |
29924954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 33763861 - 33763825
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33763861 |
accttgcatatattatgcattgtccttatcaattgag |
33763825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 37034824 - 37034756
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
37034824 |
ggtggtgtccggtgttcgaacccgcgaccttgcatatatttatgcattgtctatatcaactgagttaag |
37034756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 38139311 - 38139243
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||| |||||||| |||||| |||| |||| |
|
|
| T |
38139311 |
ggtggtgtccggggttcgaacccacgaccttgcatatatttatacattgtctatatcaactgagctaag |
38139243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 36)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 140 - 212
Target Start/End: Complemental strand, 45096097 - 45096025
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatg |
212 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||| ||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
45096097 |
gtggtgtctggggttcgaaccacagaccttgcatatattatgcattgtccttatcaactgagctaagttcatg |
45096025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 28130924 - 28130972
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28130924 |
gtggtgtccgggattcaaaccccagaccttgcatatattatgcattgtc |
28130972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 4216389 - 4216459
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||||||| |||||| |||||| ||||||||||||| ||||||||||| ||||||| |||| |||||||| |
|
|
| T |
4216389 |
ggtggtgtccagggttcgaacccc-gaccttgcatatattatgcattgtccttatcaactgagctaagttca |
4216459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 35191809 - 35191873
Alignment:
| Q |
142 |
ggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
35191809 |
ggtgtctggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaag |
35191873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 1149059 - 1149125
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||| |||||| ||||| |||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
1149059 |
gtggtgtccagggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaag |
1149125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 8075856 - 8075790
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||| |||||||||||| ||| || ||||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtctctattaactgaggtaag |
8075790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 25441490 - 25441560
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||| ||||||||||| || ||| |||| |||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagttca |
25441560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 143 - 201
Target Start/End: Original strand, 54230092 - 54230150
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||||| ||| ||| |||| |
|
|
| T |
54230092 |
gtgtccggggttcgaaccccaaaccttgcatatattatgcattgtccttaccaactgag |
54230150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 21506755 - 21506796
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21506755 |
ccggggttcaaaccccagaccttgcatattttatgcattgtc |
21506796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 25505691 - 25505739
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
25505691 |
ggtggtgtccggg-ttcgaaccccagaccttgcatatattatgcattgtc |
25505739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 30200896 - 30200831
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
30200896 |
tggtgtccggggttcgaacctcaaaccttgcatatattatgcattgtccttagcaactgagctaag |
30200831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 2078294 - 2078234
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| || ||| |||| |||||||| |||||| |
|
|
| T |
2078294 |
aaccccaaaccttgcatatattatgcattgtctctaccaactgagttaagttcacgagaac |
2078234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 2153491 - 2153539
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
2153491 |
gtggtggccagggtttaaaccccagaccttgcatatattatgcattgtc |
2153539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 14149536 - 14149584
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| | ||| ||||||| |
|
|
| T |
14149536 |
gtggtgtccggggttcgaaccccagaccttgcatacattatacattgtc |
14149584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 53996370 - 53996322
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgtc |
53996322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 149 - 188
Target Start/End: Original strand, 13829076 - 13829115
Alignment:
| Q |
149 |
ggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcattgtc |
13829115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 21914070 - 21914133
Alignment:
| Q |
149 |
ggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatg |
212 |
Q |
| |
|
||||||| ||||||| |||||||||||| ||||||||||| ||| ||| |||| |||| ||||| |
|
|
| T |
21914070 |
ggggttcgaaccccataccttgcatatattatgcattgtccttaccaactgagttaagctcatg |
21914133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 143 - 206
Target Start/End: Complemental strand, 34962997 - 34962934
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||| ||| ||||| | |||||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
34962997 |
gtgtccggtgtttgaaccctacaccttgcatatagtatgcattgtccttatcaattgagttaag |
34962934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 38573562 - 38573629
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||| |||||||||| ||||||| |||| |||| |
|
|
| T |
38573562 |
ggtggtgtccggggttcgaatcctagaccttgtatatattatgcattgttcttatcaactgagttaag |
38573629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 52119526 - 52119471
Alignment:
| Q |
162 |
cagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||||||||||| |||||||||| | |||||| | || ||||||||||||||| |
|
|
| T |
52119526 |
cagaccttgcatatattatgcattgtttctatcaaatcagttaagttcatgagaac |
52119471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 186
Target Start/End: Complemental strand, 53208042 - 53207995
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattg |
186 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
53208042 |
ggtggtgtcaagggttcgaaccccagaccttgcatatattatgcattg |
53207995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 188
Target Start/End: Original strand, 46253897 - 46253935
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
46253897 |
gggttcgaacctcagaccttgcatatactatgcattgtc |
46253935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 5428450 - 5428487
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
5428450 |
gaccttgcatatattatgcattgtttttatcaattgag |
5428487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 14771402 - 14771357
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||| |||||||| |
|
|
| T |
14771402 |
gtggtgtccgggattcgaacctcagaccttgcatatattatgcatt |
14771357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 25730473 - 25730428
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
25730473 |
gtggtggccggggttcgaaccccagaccttgtatatattatgcatt |
25730428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 33745153 - 33745104
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
33745153 |
aaccccagaccttgcatattttatgcattgtccatatcaattgagctaag |
33745104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 38130948 - 38130997
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
38130948 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
38130997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 52119446 - 52119381
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaag |
52119381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 143 - 183
Target Start/End: Complemental strand, 2522997 - 2522957
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgca |
183 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
2522997 |
gtgtccggggttcaaaccccagctcttgcatataatatgca |
2522957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 8238635 - 8238587
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtc |
8238587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 12101537 - 12101605
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
12101537 |
ggtggtgtccggggttcgaatccgcgaccttgcatatatttatgcattgtctatatcaactgagttaag |
12101605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 27397602 - 27397650
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||| ||||||| |
|
|
| T |
27397602 |
gtggtgtccggggttcgaaccttagaccttgcatatattatacattgtc |
27397650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 32843252 - 32843300
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattgtc |
32843300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 46226016 - 46226064
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtct |
189 |
Q |
| |
|
|||||| |||||||| ||| || ||||||||||||| |||||||||||| |
|
|
| T |
46226016 |
tggtgttcggggttcgaactccggaccttgcatatattatgcattgtct |
46226064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 48849753 - 48849801
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 217
Target Start/End: Complemental strand, 53222004 - 53221952
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||| |||||| ||| ||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
53222004 |
accttacatatattatacattgtccttatcaactgagttaagttcatgagaac |
53221952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 6e-16; HSPs: 38)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 7872737 - 7872808
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| ||||||||||| ||| ||| |||| |||||||| |
|
|
| T |
7872737 |
ggtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaagttca |
7872808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 46987158 - 46987091
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
46987158 |
ggtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaag |
46987091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 48007536 - 48007603
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
48007536 |
ggtggtgtcctgggttcaaactccagaccttgcatatattatgcattgtcattaccaactgagttaag |
48007603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 196
Target Start/End: Complemental strand, 43998635 - 43998590
Alignment:
| Q |
151 |
ggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
43998635 |
ggttcaaaccccaaaccttgcatatactatgcattgtccttatcaa |
43998590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 208
Target Start/End: Complemental strand, 47840728 - 47840660
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| |||||||| ||||||||||| |||||| |
|
|
| T |
47840728 |
tggtgtccggggttcaaacccgcgaccttgcatatatttatacattgtctatatcaattgagctaagtt |
47840660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 6384923 - 6384856
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||| ||||||||||| |||| || |||| |||| |
|
|
| T |
6384923 |
ggtggtgtctagggttcgaaccccagaccttgcatatattatgcattgtccttattaactgagttaag |
6384856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 23069846 - 23069913
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| |||| ||||||||| ||| |||| |||| |
|
|
| T |
23069846 |
ggtggtgtccggggttcgaaccccataccttgcatatattatgtgttgtctttaccaactgagctaag |
23069913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 8901434 - 8901372
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||| ||| ||||||||| | |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
8901434 |
cgggattcgaaccccagatcctgcatatactatgcattgtccatatcaattgagttaagttca |
8901372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 20243328 - 20243278
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcata-tactatgcattgtc |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
20243328 |
ggtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtc |
20243278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 201
Target Start/End: Complemental strand, 45425525 - 45425463
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||| ||||| ||| |||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
45425525 |
ggtggtggccgggattcgaaccccgaaccttgcatatattatgcattgtctttatcaactgag |
45425463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 2916174 - 2916125
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
2916174 |
ggtgatgtccggggttcgaatcccagaccttgcatatattatgcattgtc |
2916125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 2962717 - 2962786
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||||| |||||||| |||||| ||||||| |||||||| |
|
|
| T |
2962717 |
tggtggccgggattcaaaccccgaaccttgcatatattatgcattatctttaccaattgaactaagttca |
2962786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 22690026 - 22690071
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
22690026 |
gtggtgtccggggttcgaaccccaaaccttgcatatattatgcatt |
22690071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 26009347 - 26009302
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
26009347 |
gtggtgtccggagttcgaaccccagaccttgcatatattatgcatt |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 45979167 - 45979118
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |||| |||| |
|
|
| T |
45979167 |
aaccccagaccttgcatatattatgtattgtctttatcaaatgagttaag |
45979118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 47155093 - 47155142
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
47155093 |
ggtggtgtccggggttcgaaccctggaccttgcatatattatgcattgtc |
47155142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 20135150 - 20135218
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||| ||||||||||||||| |||| |||| |
|
|
| T |
20135150 |
ggtggtgtccggggttcgaacccgggaccttgcatatatttatacattgtctttatcaactgagctaag |
20135218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 201
Target Start/End: Original strand, 21134431 - 21134491
Alignment:
| Q |
142 |
ggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
21134431 |
ggtgtccggggttcaaacccgcgaccttgcatatatttatgcattgtctatatcaactgag |
21134491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 8903635 - 8903702
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||| ||||| ||||| |||| || |||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
8903635 |
gtgtccgaggttcgaacccaagacattacatatatcatgcattgtccttatcaattgagttaagttca |
8903702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 18714520 - 18714453
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
18714520 |
ggtggtgtacggggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaag |
18714453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 140 - 203
Target Start/End: Original strand, 22777350 - 22777412
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggt |
203 |
Q |
| |
|
|||||| ||||| ||| |||||| ||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
22777350 |
gtggtggccgggattcgaacccc-gaccttgcatatattatgcattgtccttatcaactgaggt |
22777412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 217
Target Start/End: Original strand, 24099235 - 24099302
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||||| | ||||||||||| | |||||| |||||| |
|
|
| T |
24099235 |
gggttcaaaccccgaaccttacatatattatgcattgtttatatcaattgagcttagttcacgagaac |
24099302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 192
Target Start/End: Complemental strand, 40867084 - 40867049
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40867084 |
aaccccggaccttgcatatactatgcattgtcttta |
40867049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 141 - 187
Target Start/End: Complemental strand, 9522982 - 9522936
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcattgt |
9522936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 208
Target Start/End: Complemental strand, 36769223 - 36769153
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||| |||||||| |||||| |||| |||||| |
|
|
| T |
36769223 |
ggtggtgtccggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaagtt |
36769153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 48527261 - 48527195
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||||| ||| ||| || ||||||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
48527261 |
gtggtggccgggattcgaactccggaccttgcatatattatgcattgtccttatcaactgagataag |
48527195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 8084499 - 8084450
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| ||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
8084499 |
ggtggtggccggggttcgaaccccggaccttgcatattttatgcattgtc |
8084450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 25923462 - 25923417
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
25923462 |
gtggtatctggggttcaaacctcagaccttgcatatattatgcatt |
25923417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 31038511 - 31038560
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
31038511 |
ggtggtggccggggtttgaaccccagaccttgcatacaatatgcattgtc |
31038560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 208
Target Start/End: Complemental strand, 36765570 - 36765501
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||| |||||||| |||||| |||| |||||| |
|
|
| T |
36765570 |
gtggtgtccggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaactgagctaagtt |
36765501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 143 - 191
Target Start/End: Original strand, 1627928 - 1627976
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttt |
191 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
1627928 |
gtgtctggggttcgaactccagaccttgcatatatcatgcattgtcttt |
1627976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 216
Target Start/End: Original strand, 5458081 - 5458137
Alignment:
| Q |
160 |
cccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaa |
216 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| |||| |||| ||| ||||| |
|
|
| T |
5458081 |
cccagaccttgcatatattatgcattgttcttatcaactgagctaagctcacgagaa |
5458137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 27462426 - 27462474
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
27462474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 37624614 - 37624566
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| ||||| ||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcattgtc |
37624566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 44558765 - 44558812
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44558765 |
gtggtggccggggt-caaacctcagaccttgcatatattatgcattgtc |
44558812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 44651651 - 44651615
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44651651 |
accttgcatatattatgcattgtcattatcaattgag |
44651615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 210
Target Start/End: Original strand, 45110500 - 45110560
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||||||| | ||| ||| ||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
45110500 |
gggttcaaaccacggacgttgtatatactatgcattgtccttatcaactgaactaagttca |
45110560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 188
Target Start/End: Original strand, 48629063 - 48629103
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| ||||||| ||||||||||||| ||||||||||| |
|
|
| T |
48629063 |
cggggtttaaaccccggaccttgcatatattatgcattgtc |
48629103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 39)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 139 - 201
Target Start/End: Original strand, 42168934 - 42168996
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
42168934 |
ggtggtgtctggggttcgaaccccagaccttgcatatactatgcattgtccttaccaactgag |
42168996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 152 - 196
Target Start/End: Original strand, 25607060 - 25607104
Alignment:
| Q |
152 |
gttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25607060 |
gttcgaaccccagaccttgcatatattatgcattgtctttatcaa |
25607104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 139 - 187
Target Start/End: Original strand, 31708135 - 31708183
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
31708135 |
ggtggtgtccgaggttcgaaccccagaccttgcatatattatgcattgt |
31708183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 141 - 208
Target Start/End: Complemental strand, 5846099 - 5846032
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| ||||||||||| ||| ||| |||| |||||| |
|
|
| T |
5846099 |
tggtgtccggggtttgaaccccagactttgcatatattatgcattgtccttaccaactgagctaagtt |
5846032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 26377038 - 26376967
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||||||||| |||| |||||| ||| ||||||||| ||||||||||| ||| ||| |||| |||||||| |
|
|
| T |
26377038 |
ggtggtgtccggagttcgaaccccggacgttgcatataatatgcattgtccttaccaactgagctaagttca |
26376967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 147 - 221
Target Start/End: Original strand, 16133062 - 16133136
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaacgact |
221 |
Q |
| |
|
|||||||| ||||| | ||||||||||||| ||||||||||| ||| ||| |||| |||| ||| |||||||||| |
|
|
| T |
16133062 |
ccggggtttaaacctctgaccttgcatatattatgcattgtccttaccaactgagctaagctcacgagaacgact |
16133136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 17338693 - 17338759
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
17338693 |
gtggtgtccggggttcgaacgacacaccttgcatatattatgtattgtctttaccaattgagctaag |
17338759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 217
Target Start/End: Original strand, 23118040 - 23118118
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||||||| | |||| ||||||| ||||| |||||| ||||||||||| ||||||| |||| |||| ||| |||||| |
|
|
| T |
23118040 |
ggtggtgtccagagttcgaaccccaaaccttacatatattatgcattgtccttatcaactgagttaagctcacgagaac |
23118118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 40715939 - 40716005
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaag |
40716005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 185
Target Start/End: Complemental strand, 42005177 - 42005131
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
42005177 |
ggtggtgtccgagattcaaaccccagaccttgcatatattatgcatt |
42005131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 3222803 - 3222750
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
|||||| |||||||||| |||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
3222803 |
ggtggtatccggggttcgaacctcagaccttgcatatattatgtattgtcttta |
3222750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 6489079 - 6489030
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
6489079 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtc |
6489030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 6624848 - 6624799
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
6624848 |
ggtggtggccggggttcgaaccccggaccttgcatatattatgcattgtc |
6624799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 148 - 189
Target Start/End: Original strand, 18489074 - 18489115
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtct |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
18489074 |
cggggttcaaactccagaccttgcatatattatgcattgtct |
18489115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 22499011 - 22498947
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
22499011 |
tggtgtccggggttcgaaccc-agaccttgcatatattatgcattgtccttaccaactgagttaag |
22498947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 147 - 188
Target Start/End: Complemental strand, 26590771 - 26590730
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26590771 |
ccgggattcaaaccccagaccttgcatatattatgcattgtc |
26590730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 208
Target Start/End: Original strand, 3416551 - 3416619
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||| ||| |||||| | |||||| |||| |||||| |
|
|
| T |
3416551 |
gtggtgtccggggttcgacccccagaccttgtatatattatacattgtttctatcaactgagttaagtt |
3416619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 13777788 - 13777832
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13777788 |
tggtgtccagggttcaaaccccagaccttgcatatatcatgcatt |
13777832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 141 - 212
Target Start/End: Complemental strand, 31159499 - 31159428
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatg |
212 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| |||| |||||||||||||| |||| |||| ||||| |
|
|
| T |
31159499 |
tggtgtccggggttcgaaccctgaatcttgcatatattatgtattgtctttatcaactgagttaagctcatg |
31159428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 219
Target Start/End: Complemental strand, 25979898 - 25979836
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaacga |
219 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||| |||||||||| |||| ||| || ||||| |
|
|
| T |
25979898 |
aaccccggaccttgcatacattatgcattgtcttaatcaattgagttaagctcacgaaaacga |
25979836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 206
Target Start/End: Original strand, 31305900 - 31305942
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
31305900 |
gaccttacatatattatgcattgtctttatcaattgagttaag |
31305942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 35109471 - 35109405
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||| ||| |||| | ||||||||||||| |||| |||||||||| ||| |||| |||| |
|
|
| T |
35109471 |
gtggtgtccgggattcgaacctcggaccttgcatatattatgtattgtctttaccaactgagttaag |
35109405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 36246651 - 36246717
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgag |
214 |
Q |
| |
|
|||||| ||||||||||| ||| ||||| |||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
36246651 |
cggggtccaaaccccagaacttacatatgttatgtgttgtctatatcaattgagttaagttcatgag |
36246717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 201
Target Start/End: Complemental strand, 43396926 - 43396864
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||| || ||| || |||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
43396926 |
ggtggtgtccgggaatcgaacaccggaccttacatatattatgcattgtctttgtcaattgag |
43396864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 5246171 - 5246220
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttcatgag |
214 |
Q |
| |
|
|||||||||||| |||||||||||| || |||||||| |||||| ||||| |
|
|
| T |
5246171 |
accttgcatatattatgcattgtctataccaattgagttaagtttatgag |
5246220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 217
Target Start/End: Original strand, 8545003 - 8545056
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| |||| |||| ||| |||||| |
|
|
| T |
8545003 |
gaccttgcatatattatgcattgtccttatcaactgagttaagctcacgagaac |
8545056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 11647251 - 11647198
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||| ||| |||| |||||||| |
|
|
| T |
11647251 |
aaccccaaaccttgcatatattatgcattgtccttaccaactgagttaagttca |
11647198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 146 - 206
Target Start/End: Original strand, 16166371 - 16166432
Alignment:
| Q |
146 |
tccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||| |||||| |||| |||| |
|
|
| T |
16166371 |
tccggggttcaaacccgcgaccttgcatatatttatgcattgtctatatcaactgagctaag |
16166432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 22522790 - 22522839
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
22522790 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
22522839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 26655536 - 26655487
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| ||||||||| |||||| |||||| |||||| ||||||||||| |
|
|
| T |
26655536 |
ggtggtggccggggttcgaaccccggaccttacatatattatgcattgtc |
26655487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 26927121 - 26927072
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| ||||||||| |||||| |||||| |||||| ||||||||||| |
|
|
| T |
26927121 |
ggtggtggccggggttcgaaccccggaccttacatatattatgcattgtc |
26927072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 176
Target Start/End: Original strand, 31958457 - 31958494
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata |
176 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
31958457 |
ggtggtgtccggggttcgaaccccggaccttgcatata |
31958494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 4763193 - 4763237
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||| |||||| |||||| ||||||||||||||| |||||||| |
|
|
| T |
4763193 |
aaccccggaccttacatatattatgcattgtctttaccaattgag |
4763237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 10032264 - 10032312
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10032264 |
gtggtggccggagttcaaaccccaaaccttgcatatgttatgcattgtc |
10032312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 17145340 - 17145404
Alignment:
| Q |
142 |
ggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||| ||| |||| |||| |||||||||| ||| ||||||||||| ||| |||| |||| |
|
|
| T |
17145340 |
ggtgtccgggattcgaacctcagatcttgcatatattatacattgtctttaccaactgagttaag |
17145404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 25709792 - 25709748
Alignment:
| Q |
152 |
gttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||||| | ||||||||||||| |||||||||| |||||||| |
|
|
| T |
25709792 |
gttcaaacctcggaccttgcatatattatgcattgtttttatcaa |
25709748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 32339807 - 32339759
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||| ||||| ||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
32339807 |
ggtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 37932401 - 37932353
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| || |||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtc |
37932353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 40446037 - 40445993
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
40446037 |
aacctcagaccttgcatatattatgcattgtccttatcaactgag |
40445993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 40)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 16204806 - 16204873
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
16204806 |
ggtgatgtccgggatccaaaccccagaccttgcatatattatgcattgtccttatcaactgagttaag |
16204873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 24393316 - 24393250
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcattgtccttaacaactgagctaag |
24393250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 217
Target Start/End: Original strand, 25274819 - 25274896
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
||||||| |||||||| ||||||||||||| |||||| |||||||||| ||| ||| |||| ||| ||||||||||| |
|
|
| T |
25274819 |
gtggtgttcggggttcgaaccccagaccttacatatattatgcattgttcttaccaactgagctaatttcatgagaac |
25274896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 144 - 201
Target Start/End: Complemental strand, 39761504 - 39761448
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
39761504 |
tgtccggggttcaaaccc-agaccttgcatatattatgcattgtccttatcaactgag |
39761448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 2257042 - 2256994
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtc |
2256994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 24592835 - 24592906
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| ||||||||||| || ||| |||| |||||||| |
|
|
| T |
24592835 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagttca |
24592906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 39068697 - 39068764
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||| |||||||||||||| || |||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
39068697 |
ggtggtgtatggggttcaaaccccggatcttgcatatattatgcattgtccttatcaactgagctaag |
39068764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 185
Target Start/End: Complemental strand, 27152425 - 27152379
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |||||||| |
|
|
| T |
27152425 |
ggtggtgtcctgggttcgaaccccagaccttgcatatattatgcatt |
27152379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 151 - 188
Target Start/End: Original strand, 41526777 - 41526814
Alignment:
| Q |
151 |
ggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41526777 |
ggttcgaaccccagaccttgcatatactatgcattgtc |
41526814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 3243369 - 3243437
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||| |||||||| ||||||||||| |||| |
|
|
| T |
3243369 |
ggtggtgtccggggttcgaacccgcgaccttgcatatatttatacattgtctatatcaattgagctaag |
3243437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 7792342 - 7792282
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||||||| |||| || |||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
7792342 |
gggttcaaacctcagattttacatatattatgcattgtctttatcaattgagctaaattca |
7792282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 12413564 - 12413508
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
12413564 |
gtggtgtacggggtttgaacctcagaccttgcatatattatgcattgtccttatcaa |
12413508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 12425624 - 12425568
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
12425624 |
gtggtgtacggggtttgaacctcagaccttgcatatattatgcattgtccttatcaa |
12425568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 192
Target Start/End: Complemental strand, 21258687 - 21258635
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
21258687 |
gtggtggccgggattcgaaccccagaccttgcatatatcatgcattgtcttta |
21258635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 34903588 - 34903540
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||| |||| |
|
|
| T |
34903588 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcactgtc |
34903540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 144 - 206
Target Start/End: Complemental strand, 10058938 - 10058876
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagacctt-gcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||| || |||||||| |||| |
|
|
| T |
10058938 |
tgtccggggttcaaacccc-gacctttgcatatattatgcattgtctctaccaattgagttaag |
10058876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 145 - 196
Target Start/End: Original strand, 11810377 - 11810428
Alignment:
| Q |
145 |
gtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||| ||||||||||| ||||||| |
|
|
| T |
11810377 |
gtccggggttcgaaccccagactttgcacatattatgcattgtccttatcaa |
11810428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 141 - 192
Target Start/End: Original strand, 24520630 - 24520681
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
||||||| ||||||| | ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
24520630 |
tggtgtctggggttcgagccccagaccatgcatatattatgcattgtcttta |
24520681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 24593448 - 24593381
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||| | |||||| |||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
24593448 |
ggtggtgttcagggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaag |
24593381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 29544699 - 29544632
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
29544699 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctaccaattgagctaag |
29544632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 32091160 - 32091227
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||| | | ||||||||| |||||||||||||| |||||||| || ||| |||||||| |||| |
|
|
| T |
32091160 |
ggtggtgtctgagattcaaaccctagaccttgcatatattatgcattttccttaccaattgagttaag |
32091227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 20455962 - 20455896
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||||| ||| |||||| ||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccataccaattgagctaag |
20455896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 201
Target Start/End: Complemental strand, 28771654 - 28771592
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||||||| |||| | || |||||||||| ||||||||||| ||| ||| |||| |
|
|
| T |
28771654 |
ggtggtgtccggggttcgaaccgcggatcttgcatatattatgcattgtccttaccaactgag |
28771592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 176
Target Start/End: Original strand, 2939772 - 2939809
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata |
176 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
2939772 |
ggtgatgtccggggttcgaaccccagaccttgcatata |
2939809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 4122010 - 4122051
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
4122010 |
ccgggatttaaaccccagaccttgcatatattatgcattgtc |
4122051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 7302151 - 7302208
Alignment:
| Q |
160 |
cccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| |||| |||||||| |||||| |
|
|
| T |
7302151 |
cccagaccttgcatattttatgcattgtccctatcaactgagctaagttcacgagaac |
7302208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 187
Target Start/End: Complemental strand, 13143169 - 13143132
Alignment:
| Q |
150 |
gggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13143169 |
gggttcaaacccccgaccttgcatatattatgcattgt |
13143132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 22571872 - 22571925
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||| |||||| |||| |||||||| |
|
|
| T |
22571872 |
aaccccggacattgcatatattatgcattgtctatatcaactgagctaagttca |
22571925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 192
Target Start/End: Original strand, 31048305 - 31048358
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtcttta |
192 |
Q |
| |
|
||||||||||||||||| || | | |||||||||||| ||||||||||||||| |
|
|
| T |
31048305 |
ggtggtgtccggggttcgaatctcgaaccttgcatataatatgcattgtcttta |
31048358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 205
Target Start/End: Complemental strand, 39090915 - 39090878
Alignment:
| Q |
168 |
ttgcatatactatgcattgtctttatcaattgaggtaa |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
39090915 |
ttgcatatattatgcattgtctttatcaattgaagtaa |
39090878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 42066784 - 42066735
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
42066784 |
ggtggtggccgaggttcaaaccccggaccttgcatatattgtgcattgtc |
42066735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 833075 - 833107
Alignment:
| Q |
156 |
aaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
833075 |
aaaccccagaccttgcatatattatgcattgtc |
833107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 147 - 187
Target Start/End: Original strand, 6579278 - 6579318
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
6579278 |
ccgggattcgaaccccagaccttgcatatattatgcattgt |
6579318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 9383199 - 9383247
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| | |||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
9383199 |
gtggtggcaggggttgaaaccccaaaccttgcatatattatgcattgtc |
9383247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 9389530 - 9389478
Alignment:
| Q |
149 |
ggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||| |||| || |||||||||||| |
|
|
| T |
9389530 |
ggggttcgaactccagaccttgcatatattatacattatccttatcaattgag |
9389478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 217
Target Start/End: Original strand, 9519729 - 9519781
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||| |||| ||| |||||| |
|
|
| T |
9519729 |
accttgcatatattatgcattgtccatatcaattgagctaagctcacgagaac |
9519781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 188
Target Start/End: Original strand, 12599863 - 12599903
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| |||||| |
|
|
| T |
12599863 |
cggggttcgaaccccagaccttgcatatattatgtattgtc |
12599903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 183
Target Start/End: Complemental strand, 27411164 - 27411120
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgca |
183 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
27411164 |
ggtggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 212
Target Start/End: Complemental strand, 42200758 - 42200686
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatg |
212 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||| |||| |||||||||| ||| |||| ||| |||||| |
|
|
| T |
42200758 |
gtggtgtccggaattcgaacatcagaccttgcatatattatgtattgtctttaccaactgagttaacttcatg |
42200686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 44694733 - 44694689
Alignment:
| Q |
166 |
ccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |||| |||||||| |
|
|
| T |
44694733 |
ccttgcatatattatgcattgtctatatcaactgagttaagttca |
44694689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 22)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 142 - 196
Target Start/End: Original strand, 28046170 - 28046224
Alignment:
| Q |
142 |
ggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
28046170 |
ggtgttcggggttcaaacctcaaaccttgcatatattatgcattgtctttatcaa |
28046224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 334194 - 334145
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
334194 |
aaccccagaccttgcatatattatgcattgtctttatcaactgagctaag |
334145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 139 - 187
Target Start/End: Original strand, 12700410 - 12700458
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
12700410 |
ggtggtggccggggttcaaaccctagaccttgcatatattatgcattgt |
12700458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 140 - 200
Target Start/End: Original strand, 28592677 - 28592737
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattga |
200 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
28592677 |
gtggtgtccgaggttcgaaccccagaccttacatatattatgcattgtctttgccaattga |
28592737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 4450333 - 4450267
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||| | ||| |||||| ||||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcattgtctttatcaactgagctaag |
4450267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 21047811 - 21047768
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21047811 |
gtggtgtccggggttcaaaccc--gaccttgcatatactatgcatt |
21047768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 26400934 - 26400869
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| |||| |||||| || |||||||| |||| |
|
|
| T |
26400934 |
tggtggccggggttcaaaccccggaccttgcatatattatgtattgtccataccaattgagctaag |
26400869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 2726407 - 2726455
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgtc |
2726455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 218
Target Start/End: Complemental strand, 4553796 - 4553729
Alignment:
| Q |
151 |
ggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaacg |
218 |
Q |
| |
|
|||| |||||| |||||||||| ||| || |||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
4553796 |
ggttaaaaccctagaccttgcacatattaagcattgtccgtatcaattgagttaagttcacgagaacg |
4553729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 12808931 - 12808893
Alignment:
| Q |
149 |
ggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
12808931 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
12808893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 144 - 206
Target Start/End: Complemental strand, 19581514 - 19581452
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||||| || | || |||||||||||| |||| || |||||||||||||||| |||| |
|
|
| T |
19581514 |
tgtccggggttcgaatcacaaaccttgcatatattatgtatagtctttatcaattgagctaag |
19581452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 21095592 - 21095553
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21095592 |
tgtccggggttcaaaccc--gaccttgcatatactatgcatt |
21095553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 165 - 219
Target Start/End: Original strand, 23629852 - 23629906
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaacga |
219 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||||| |||||||| ||| |||| |
|
|
| T |
23629852 |
accttgcatatattatgcattgtcattaccaattgagctaagttcacgaggacga |
23629906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 655746 - 655787
Alignment:
| Q |
147 |
ccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
655746 |
ccggggttcgaaccccggaccttgcatatattatgcattgtc |
655787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 2262191 - 2262232
Alignment:
| Q |
160 |
cccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
2262191 |
cccagaccttgcatacattatgcattgtctttaccaattgag |
2262232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 8569780 - 8569719
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaattgag |
8569719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 9333970 - 9334031
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||| |||||| ||||||||||| || |||| |||| |
|
|
| T |
9333970 |
gtggtgtccgaggttcgaaccccaaaccttacatatattatgcattgtccttgtcaactgag |
9334031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 14550583 - 14550526
Alignment:
| Q |
151 |
ggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
||||| |||||| ||| |||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
14550583 |
ggttcgaaccccggactttgcatattttatgcattgtctatatcaattgagttaagtt |
14550526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 24373700 - 24373761
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||| | |||||| |||||| ||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
24373700 |
gtggtggctggggtttgaacccctgaccttgcatatattatgcattgtctctaccaattgag |
24373761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 33824935 - 33824886
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
33824935 |
aaccccggaccttgcatatattatgcattgtccttatcaactgagctaag |
33824886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 20744201 - 20744161
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
20744201 |
cggggtttgaaccccagaccttgcatatattatgcattgtc |
20744161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 29431530 - 29431474
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
||||||||||||| || |||| |||||||| |||| | ||||||||||| ||||||| |
|
|
| T |
29431530 |
gtggtgtccggggatcgaacctcagaccttacatacattatgcattgtccttatcaa |
29431474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 39)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 46708384 - 46708330
Alignment:
| Q |
349 |
ttttgcctgcagttcaatctttgtttgatacaatatttgctgaagatctgtgctg |
403 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||||||| |||||||| |
|
|
| T |
46708384 |
ttttggctgcagttcaatttttgttggatacaatatttgctgaagaactgtgctg |
46708330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 11354012 - 11354052
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11354012 |
tgtccggggttcaaaccccagaccttgcatatattatgcat |
11354052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 146 - 206
Target Start/End: Original strand, 28039856 - 28039916
Alignment:
| Q |
146 |
tccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
28039856 |
tccggggttcaaacctcagaccttgcatatattatgcattgtccttaccaactgagttaag |
28039916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 21638185 - 21638118
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |||||||||| || |||||||| |||| |
|
|
| T |
21638185 |
ggtggtgtccggggttcgaaccccggaccttgcatatatcatgcattgtccgtaccaattgagctaag |
21638118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 141 - 196
Target Start/End: Complemental strand, 30937545 - 30937490
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
30937545 |
tggtgtccggagttcgaaccccagaccttgcatatattatacattgtccttatcaa |
30937490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 141 - 196
Target Start/End: Original strand, 34366290 - 34366345
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
34366290 |
tggtgtccagggttcaaacctcagaccttgcatatgttatgcactgtctttatcaa |
34366345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 38448855 - 38448922
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
38448855 |
ggtggtgtccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaag |
38448922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 52441500 - 52441567
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||| ||||||||||||| || ||||||||||||| |||||||||||| || ||| |||| |||| |
|
|
| T |
52441500 |
ggtggtggccggggttcaaacgccggaccttgcatatattatgcattgtctataccaactgagctaag |
52441567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 10132434 - 10132504
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| ||||||||||| ||| ||| ||| |||||||| |
|
|
| T |
10132434 |
gtggtgtccaaggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgatctaagttca |
10132504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 3136678 - 3136739
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||| ||| ||||| ||||||| |||||| ||||||||||||||| |||||||| |
|
|
| T |
3136678 |
gtggtgtccggaattcgaaccctagaccttacatatattatgcattgtctttaccaattgag |
3136739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 143 - 187
Target Start/End: Complemental strand, 11681291 - 11681247
Alignment:
| Q |
143 |
gtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
11681291 |
gtgtccggggtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 208
Target Start/End: Original strand, 23171287 - 23171355
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagtt |
208 |
Q |
| |
|
|||||||| | | |||||||||| || ||||||||||||||||||||| |||| ||| |||| |||||| |
|
|
| T |
23171287 |
gtggtgtctgagattcaaaccccggatcttgcatatactatgcattgtttttaccaactgagctaagtt |
23171355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 41973326 - 41973278
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtc |
41973278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 201
Target Start/End: Original strand, 23730368 - 23730431
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| ||||| || |||||||||| |||| |
|
|
| T |
23730368 |
ggtggtgtccggggttcgaaccccggaccttgcatatatttatgcgttatctttatcaactgag |
23730431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 35474024 - 35473957
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |||||||| || ||| |||||||| |||| |
|
|
| T |
35474024 |
ggtggtgtccggggttcgaaccctgaaccttgcatatattatgcattatccttaccaattgagctaag |
35473957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 142 - 185
Target Start/End: Original strand, 42946493 - 42946536
Alignment:
| Q |
142 |
ggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
42946493 |
ggtgtccggggttcaaaccccagcccctgcatataatatgcatt |
42946536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 47528436 - 47528503
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||||||||||| |||| | |||||||| |||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
47528436 |
ggtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaag |
47528503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 185
Target Start/End: Complemental strand, 3481633 - 3481587
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcatt |
185 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
3481633 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 9639807 - 9639873
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||||||| ||||| ||| || ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
9639807 |
gtggtgtccgaggttcgaactccggaccttgcatatattatgcattgtccttaccaagtgagttaag |
9639873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 168 - 214
Target Start/End: Complemental strand, 13779621 - 13779575
Alignment:
| Q |
168 |
ttgcatatactatgcattgtctttatcaattgaggtaagttcatgag |
214 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
13779621 |
ttgcatatattatgcattgtctatatcaactgagctaagttcatgag |
13779575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 17284022 - 17283956
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
17284022 |
gtggtgtccagggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaag |
17283956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 24752636 - 24752686
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcata-tactatgcattgtc |
188 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
24752636 |
ggtggtggccggggttcgaaccccagaccttgcatattattatgcattgtc |
24752686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 214
Target Start/End: Original strand, 31061917 - 31061967
Alignment:
| Q |
164 |
gaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgag |
214 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||| |||| |||||||||||| |
|
|
| T |
31061917 |
gaccttgcatataatatgcattgtccttaccaactgagttaagttcatgag |
31061967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 217
Target Start/End: Complemental strand, 127145 - 127068
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttcatgagaac |
217 |
Q |
| |
|
|||||| ||||| || ||||||| ||||||||||||| |||||||||| ||| || ||||| |||| ||| |||||| |
|
|
| T |
127145 |
gtggtggccgggatttaaaccccggaccttgcatatataatgcattgtccttaccagttgagctaagctcacgagaac |
127068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 5280694 - 5280653
Alignment:
| Q |
148 |
cggggttcaaaccccagaccttgcatatactatgcattgtct |
189 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
5280694 |
cggggttcgaaccccagaccttgcatatattatgcactgtct |
5280653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 5907871 - 5907822
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
5907871 |
ggtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtc |
5907822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 16033440 - 16033501
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
16033501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 209
Target Start/End: Original strand, 27525860 - 27525929
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaagttc |
209 |
Q |
| |
|
|||||||||||||||| ||||||| | | | |||||| ||| |||||| ||||||| |||||||||||| |
|
|
| T |
27525860 |
gtggtgtccggggttcgaaccccaaatcatacatatattattaattgtccttatcaactgaggtaagttc |
27525929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 32075259 - 32075304
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttca |
210 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||| |||||||| |
|
|
| T |
32075259 |
accttgcatatactatgtattgtccttatcaactgagctaagttca |
32075304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 32944808 - 32944759
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||||||| ||||||||||| |
|
|
| T |
32944808 |
ggtggtggtcggggttcgaaccccagacgttgcatatattatgcattgtc |
32944759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 42045361 - 42045410
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
42045361 |
ggtggtggccggggtttgaactccagaccttgcatatattatgcattgtc |
42045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 44221059 - 44221002
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaa |
196 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||||| | |||||||||| |||||| |
|
|
| T |
44221059 |
ggtggtgtccaaggttcgaaccccagaccttgtatatattgtgcattgtctctatcaa |
44221002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 46040560 - 46040613
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatata-ctatgcattgtcttt |
191 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
46040560 |
ggtggtgtccggggttcgaacccgggaccttgcatatatttatgcattgtcttt |
46040613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 47417829 - 47417780
Alignment:
| Q |
165 |
accttgcatatactatgcattgtctttatcaattgaggtaagttcatgag |
214 |
Q |
| |
|
|||||||||||| ||||||||||| | | |||||||| |||||||||||| |
|
|
| T |
47417829 |
accttgcatatattatgcattgtcctaaccaattgagttaagttcatgag |
47417780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 6000133 - 6000181
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||||| ||||||||||| |
|
|
| T |
6000133 |
gtggtgtccggggtttgaacctcggaccttgcatatattatgcattgtc |
6000181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 29233973 - 29234013
Alignment:
| Q |
149 |
ggggttcaaaccccagaccttgcatatactatgcattgtct |
189 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
29233973 |
ggggttcgaaccccagaccttgcatattttatgcattgtct |
29234013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 139 - 187
Target Start/End: Original strand, 37045135 - 37045183
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
37045135 |
ggtggtgtctggggttcgaaccctggaccttgcatatattatgcattgt |
37045183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 201
Target Start/End: Original strand, 41142697 - 41142737
Alignment:
| Q |
161 |
ccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
41142697 |
ccagaccttgcatatattatgcattgtctctatcaactgag |
41142737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 45481560 - 45481516
Alignment:
| Q |
144 |
tgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
45481560 |
tgtccggagttcgaaccccggaccttgcatatattatgcattgtc |
45481516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0354 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 201
Target Start/End: Original strand, 7209 - 7271
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||| ||||| |||| ||||||| |
|
|
| T |
7209 |
ggtggtgtccggggttcgaaccccagaccttatatataatatgcgttgtccttattaattgag |
7271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 17575 - 17527
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtc |
188 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
17575 |
gtggtgtccgggattcgaaccccaaaccttgcatatattatgcattgtc |
17527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 206
Target Start/End: Complemental strand, 25461 - 25394
Alignment:
| Q |
139 |
ggtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||| ||||||||||| ||| ||| |||| |||| |
|
|
| T |
25461 |
ggtggtgtctggggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagttaag |
25394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 14807 - 14853
Alignment:
| Q |
141 |
tggtgtccggggttcaaaccccagaccttgcatatactatgcattgt |
187 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14807 |
tggtggccggggttcaaaccccggaccttgcatattttatgcattgt |
14853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 15920 - 15986
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgaggtaag |
206 |
Q |
| |
|
|||||| | |||||| |||||||||||||||||||| ||| ||||||| ||| |||||||| |||| |
|
|
| T |
15920 |
gtggtggctggggtttgaaccccagaccttgcatatattatacattgtccttaccaattgagttaag |
15986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 75396 - 75335
Alignment:
| Q |
140 |
gtggtgtccggggttcaaaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||| ||||| ||| |||||| ||||||||||||| ||||||||||| ||| ||| |||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgag |
75335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 99091 - 99047
Alignment:
| Q |
157 |
aaccccagaccttgcatatactatgcattgtctttatcaattgag |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
99091 |
aaccccagaccttgcatatattatgcattgtccctatcaactgag |
99047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University