View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_high_19 (Length: 300)
Name: NF10039_high_19
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10039_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 21 - 171
Target Start/End: Complemental strand, 36468512 - 36468362
Alignment:
| Q |
21 |
accattgaagataaataagggtttttggtttttcgtgtgtatattaggggagttagaatgttagaacttggaaatggaggggtggaattctaagaggaga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36468512 |
accattgaagataaataagggtttttggtttttcgtgtgtatattaggggagttagaatgttagaacatggaaatggaggggtggaattctaagaggaga |
36468413 |
T |
 |
| Q |
121 |
agaagaggagcgtgatgatagcggtggtgtgttactggaggccaggtggag |
171 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36468412 |
agaagaggagcgtaatgatagcggtggtgtgttactggaggccaggtggag |
36468362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University