View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_high_23 (Length: 251)
Name: NF10039_high_23
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10039_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 3561431 - 3561201
Alignment:
| Q |
10 |
catgtgtttgattgctaatttctttgcaggttcttttagttctattatgtatttcaaaggaggttatgcttttatttgtttttggtaaaagaattgtagt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3561431 |
catgtctttgattgctaatttctttgcaggttcttttagttctattatgtatttcaaaggaggttatgcttttatttgtttttggtaaaagaattgtagt |
3561332 |
T |
 |
| Q |
110 |
atcattaataccttttttgctccttagtttatttagatgctgttatgatagagcttaacattttgtggacttgatgtttttgatatattagtc-tttaag |
208 |
Q |
| |
|
|||||| ||| | ||||||| |||||||| ||| ||||| |||| | |||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
3561331 |
atcatttataac-tttttgcaccttagttaattcagatgttgttgtaatagagcttaacattttgtggacttgatgtttttgaaatattagtcttttaag |
3561233 |
T |
 |
| Q |
209 |
tttatgtaattgtaaaa-tttatgttcatatt |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
3561232 |
tttatgtaattgtaaaactttatgttcatatt |
3561201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 3585006 - 3584776
Alignment:
| Q |
9 |
gcatgtgtttgattgctaatttctttgcaggttcttttagttctattatgtatttcaaaggaggttatgcttttatttgtttttggtaaaagaattgtag |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3585006 |
gcatgtctttgattgctaatttctttgcaggttcttttagttctttcatgtatatcaaaggaggttatgcttttatttgtttttggtaaaagaattgtag |
3584907 |
T |
 |
| Q |
109 |
tatcattaataccttttttgctccttagtttatttagatgctgttatgatagagcttaacattttgtggacttgatgtttttgatatattagtctttaag |
208 |
Q |
| |
|
||||||| ||| | ||||||| |||||||| ||| ||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3584906 |
tatcatttataac-tttttgcaccttagttaattcagatgttgttgtaatagagcttaacattttgtggacttgatgtttttgatatattagtctttaag |
3584808 |
T |
 |
| Q |
209 |
tttatgtaattgtaaaa-tttatgttcatatt |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
3584807 |
tttatgtaattgtaaaactttatgttcatatt |
3584776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University