View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_high_33 (Length: 232)
Name: NF10039_high_33
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10039_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 55169005 - 55169205
Alignment:
| Q |
14 |
caaaggattaatacgaccctatataaaaatctaagtgactagtttggatataannnnnnnatccaagactagttgcaaggaaattacgaaagatcaaatt |
113 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55169005 |
caaaggattaatgcgaccctatataaaaatctaagtgactagtttggatataatttttttatataagactagttgcaaggaaattacgaaagatcaaatt |
55169104 |
T |
 |
| Q |
114 |
ggggtaaagtctaaaaatactcaagaacgatagtgtagcttacttgttaccgaggagagtgtggagttttatgatgagttgatcttcttgttgggtgaaa |
213 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55169105 |
ggg-taaagtctaaaaatactcaagaacgatagtgtagcttacttgttaccgaggagagtgtggagttttatgatgagttgatcttcttgttgggtgaaa |
55169203 |
T |
 |
| Q |
214 |
tt |
215 |
Q |
| |
|
|| |
|
|
| T |
55169204 |
tt |
55169205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University