View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_low_10 (Length: 440)
Name: NF10039_low_10
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10039_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 19 - 434
Target Start/End: Original strand, 46892291 - 46892706
Alignment:
| Q |
19 |
cttctacctctcaaaatatcttgaattcattgacactctcttcataatcctatcaagatccatcaaacgcctctcattcctccacgtgtaccatcattca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892291 |
cttctacctctcaaaatatcttgaattcattgacactctcttcatcatcctatcaagatccatcaaacgcctctcattcctccacgtgtaccatcattca |
46892390 |
T |
|
| Q |
119 |
accgtcccagtcatgtgttatctatggcttaattcttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892391 |
accgtcccagtcatgtgttatctatggcttaattcttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactctt |
46892490 |
T |
|
| Q |
219 |
actacttcctcaccaccgttggtatccgaccgccttggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtct |
318 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892491 |
actacttcctcaccaccgttggaatccgaccgccttggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtct |
46892590 |
T |
|
| Q |
319 |
catgctttattatcacttcggatccgatggtggtggatgctctgggatgaaggcttggtgtttcaatgctgtttttaatgcttctcttttggctcttttt |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892591 |
catgctttattatcacttcggatccgatggtggtggatgctgtgggatgaaggcttggtgtttcaatgctgtttttaatgcttctcttttggctcttttt |
46892690 |
T |
|
| Q |
419 |
cttgatgtccatctca |
434 |
Q |
| |
|
|||||| | ||||||| |
|
|
| T |
46892691 |
cttgattttcatctca |
46892706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University