View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_low_32 (Length: 254)
Name: NF10039_low_32
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10039_low_32 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 45744816 - 45745060
Alignment:
Q |
10 |
agcagcagagaactggatccaggtcatattggtctcgtacacggtaaaaaacaaatattttatactaaaggagacaggaatagaagcatcaactgtattg |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45744816 |
agcagcagagaactggatccaggtcatattggtctcgtacacggtaaaaaacaaatattttatactaaaggagacaggaatagaagcatcaactgtattg |
45744915 |
T |
 |
Q |
110 |
tttatacagcaaagattgaaaaatccaagatttaaaatttccatgcagttttaaatactaaaagatgccaaacagatatatgaagtttcaaagctaaaca |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45744916 |
tttatacagcaaagattgaaaaatccaagatttaaaatttccatgcagttttaaatactaaaagatgccaaacagatatatgaagtttcaaagctaaaca |
45745015 |
T |
 |
Q |
210 |
atataagccttgattcactaatctctaggagtactagaagtggac |
254 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45745016 |
atataagccttgattcactaatctctaggagtactagaagtggac |
45745060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University