View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_low_33 (Length: 252)
Name: NF10039_low_33
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10039_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 53 - 247
Target Start/End: Original strand, 5190034 - 5190228
Alignment:
Q |
53 |
cctctttctatgcttaattaggtaaccagtttataaatatcatatcaccgacaccttttaagagtgattaagggtcaagattaactatagctcgaaattg |
152 |
Q |
|
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
5190034 |
cctctttctatgcttaattaggtagccactttataaatatcatatcaccgacaccttttaagagtgattaagggtcaagattaactatagctagaaattg |
5190133 |
T |
 |
Q |
153 |
acagtggatttacaagcttatgtgactgtgagagtgaataaaacattgttgattcaattccctctaacatggaaagatcatcactctctgcttct |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
5190134 |
acagtggatttacaagcttatgtgactgtgagagtgaataaaacattgttgattcaattccctctaacatggaaagatcatcactctcttcttct |
5190228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 5189957 - 5190009
Alignment:
Q |
1 |
ctcctagttttttagggcattctctctctaatctttataatcttcttcaattc |
53 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5189957 |
ctcctagttttttagggcattctctctctaatctttataatcttcttcaattc |
5190009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University