View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10039_low_57 (Length: 209)
Name: NF10039_low_57
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10039_low_57 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 157
Target Start/End: Original strand, 33779031 - 33779177
Alignment:
| Q |
11 |
aagcagagaaaactaaaaggtgagacaggtttcttacttgaaaacaccgttgctccaacgctcaagcatgtcaccaagattcactacgaatgccctgcaa |
110 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33779031 |
aagcacagaaaaccaaaaggtgagacaggtttcttacttgaaaacaccgttgctccaacgctcaagcatgtcaccaagattcactacgaatgccctgcaa |
33779130 |
T |
 |
| Q |
111 |
taaaagcaaccagttaaataatgtaagtagcttgggagaagaaggtg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33779131 |
taaaagcaaccagttaaataatgtaagtagcttgggagaacaaggtg |
33779177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University