View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10040_high_9 (Length: 227)
Name: NF10040_high_9
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10040_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 211
Target Start/End: Original strand, 8187967 - 8188170
Alignment:
| Q |
8 |
gagcagcacagattccatcagtaattcatattagaacaagtatatatcagtaggttcagacgttcagttcccaattcaatcggttgaacacgccggtctg |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8187967 |
gagcagcacaaattccatcagtaattcatattagagcaagtatttatcagtaggttcagacgttcagttcccaattcaatcggttgaacacgccggtctg |
8188066 |
T |
|
| Q |
108 |
gtccagttttgattacattgtgaatgaatnnnnnnntactttcaaagtgaaaaatattgtatgtcacttctttcctggggagttctctgatgcaagaatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||| | |||||||||||||||||| |
|
|
| T |
8188067 |
gtccagttttgattacattgtgaatgaataaaaaaatactttcaaagtgaaaaatattgtatgtcactactttcttgggaatttctctgatgcaagaatg |
8188166 |
T |
|
| Q |
208 |
tttt |
211 |
Q |
| |
|
|||| |
|
|
| T |
8188167 |
tttt |
8188170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University