View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10040_low_13 (Length: 241)
Name: NF10040_low_13
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10040_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 7066916 - 7066694
Alignment:
| Q |
1 |
tttcaagcattaatgtagcagatgattcagcagctgccatgcaactttttctcatgaacccttctcaatctcatcaaacaacaacttcatcatcttctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7066916 |
tttcaagcattaatgtagcagatgattctgcagctgccatgcaactttttctcatgaacccttctcaatctcatcaaacaacaacttcatcatcttctcc |
7066817 |
T |
 |
| Q |
101 |
tcctccaactcatcatcaaaattcttcaactcttcacatgttactccctaaccctcctaataattccttacaaggttttccaaattctggtaattttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7066816 |
tcctccaactcatcatcaaaattcttcaactcttcacatgttactccctaaccctcctaataattccttacaaggttttccaaattctggtaattttgga |
7066717 |
T |
 |
| Q |
201 |
caattcacatggaatagtactac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7066716 |
caattcacatggaatagtactac |
7066694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 61
Target Start/End: Original strand, 33456118 - 33456152
Alignment:
| Q |
27 |
tcagcagctgccatgcaactttttctcatgaaccc |
61 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33456118 |
tcagcagctgccatgcagctttttctcatgaaccc |
33456152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University