View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10040_low_16 (Length: 227)

Name: NF10040_low_16
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10040_low_16
NF10040_low_16
[»] chr4 (1 HSPs)
chr4 (8-211)||(8187967-8188170)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 211
Target Start/End: Original strand, 8187967 - 8188170
Alignment:
8 gagcagcacagattccatcagtaattcatattagaacaagtatatatcagtaggttcagacgttcagttcccaattcaatcggttgaacacgccggtctg 107  Q
    |||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8187967 gagcagcacaaattccatcagtaattcatattagagcaagtatttatcagtaggttcagacgttcagttcccaattcaatcggttgaacacgccggtctg 8188066  T
108 gtccagttttgattacattgtgaatgaatnnnnnnntactttcaaagtgaaaaatattgtatgtcacttctttcctggggagttctctgatgcaagaatg 207  Q
    |||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||| ||||| |||| | ||||||||||||||||||    
8188067 gtccagttttgattacattgtgaatgaataaaaaaatactttcaaagtgaaaaatattgtatgtcactactttcttgggaatttctctgatgcaagaatg 8188166  T
208 tttt 211  Q
    ||||    
8188167 tttt 8188170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University