View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10040_low_4 (Length: 344)
Name: NF10040_low_4
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10040_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 305
Target Start/End: Original strand, 179448 - 179743
Alignment:
| Q |
10 |
atggacatcacagacatggcggtttatttagattctctcctttcaattaatctcatcaataccaccagctcaaagttccatattcatgtagcccttatcc |
109 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
179448 |
atgggcatcacagatatggcggtttattcagattctctcctttcaattaatctcatcactaccaccagttcaaagttccatattcatgcggccctaatcc |
179547 |
T |
 |
| Q |
110 |
aagacatcagagacaagctttctctaaagaatttttcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaat |
209 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
179548 |
aagatatcagagacaagctttctctaaggaatttttcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaat |
179647 |
T |
 |
| Q |
210 |
gtcagatatcaacgtcctaatacaccagttgcctccggatgagctacgccctttgttgaagattgatgcagcaggaaccttgtttctgagatctta |
305 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
179648 |
gtcagatgtcaacgttctaatacaccagtcgcctccggatgaactctgccctttgttgaagaatgatgcagcaggaaccttgttcctgagatctta |
179743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 45440057 - 45440000
Alignment:
| Q |
10 |
atggacatcacagacatggcggtttatttagattctctcctttcaattaatctcatca |
67 |
Q |
| |
|
|||| |||| |||| |||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45440057 |
atgggcatctcagatatggttgtttatttagattccctcctttcaattaacctcatca |
45440000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University