View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10040_low_7 (Length: 292)
Name: NF10040_low_7
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10040_low_7 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 7 - 292
Target Start/End: Complemental strand, 37717593 - 37717308
Alignment:
Q |
7 |
tttggagttggtatgacattcaatggatgaacgagtggtcgcggccatcagacgtatgtgacagacataattattgtggtagctttagcagctgcaacaa |
106 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37717593 |
tttggaggtggtatgacattcaatggatgaacgagtggtcgcggccatcagacgtatgtgacagacataattattgtggtagctttagcagctgcaacaa |
37717494 |
T |
 |
Q |
107 |
aaataattggataccgtgtaagtgtttgccaggatttcgtcgcaggttgtcggataatgatcatggttaccttggagaacgctatcaaggatgtgttaga |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
37717493 |
aaataattggataccgtgtaagtgtttgccaggatttcgtcgcaggttgtcggataatgatcatggttaccttggagaacgctaccaaggatgtgttaga |
37717394 |
T |
 |
Q |
207 |
aaatcatccaaacagtgtgtcacagcagctaccgacaataacatgatattcatcaaactaaccaacattaaagtgggaaacccaga |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
37717393 |
aaatcatccaaacagtgtgtcacagcagctaccgacaataacatgatattcatcaaactaaccaacataaaagtgggaaacccaga |
37717308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University