View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10040_low_8 (Length: 271)
Name: NF10040_low_8
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10040_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 50149357 - 50149596
Alignment:
| Q |
19 |
ctgcagttctttgtaaactactagatgaatattccatggtgacataactgtaaacaatattataaaa--aactactcgacgaaactagcttatcccactg |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50149357 |
ctgcaattctttgtaaactactagatgaatattccatggtgacataactgtaaacaatattataaaaaaaactactcgacgaaactagcttatcccactg |
50149456 |
T |
 |
| Q |
117 |
caattggttgaacacttgaactggaactatgtgtgtctcattggttctatcttctgctacgtgtttaaaacactgcataaacatagtattagaattatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50149457 |
caattggttgaacacttgaactggaactatgtgtgtctcattggttctatcttctgctacgtgtttaaaacactgcataaacatagtattagaattatat |
50149556 |
T |
 |
| Q |
217 |
aaatagtttcaacttaaactattaatatacactcttgttc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50149557 |
aaatagtttcaacttaaactattaatatacactcttgttc |
50149596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University