View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10040_low_9 (Length: 253)
Name: NF10040_low_9
Description: NF10040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10040_low_9 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 35445962 - 35446202
Alignment:
| Q |
13 |
tggtggtccagtggctattctggcagcactttgggccttagtaaacttcccaactacaaaattccccgatcgtatccctcccatctgtattacttttggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35445962 |
tggtggtccagtggctattctggcagcactttgggccttagtaaacttcccaactacaaaattccccgatcgtatccctcccatctgtattacttttggt |
35446061 |
T |
 |
| Q |
113 |
tctcctttagttggaaatcacatattttctcatgctacaaggagagaaaattggactgaccacttcttccattttgtgatgagatatgacatagtgccaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446062 |
tctcctttagttggaaatcacatattttctcatgctacaaggagagaaaattggactgaccacttcttccattttgtgatgagatatgacatagtgccaa |
35446161 |
T |
 |
| Q |
213 |
gaatcctccttgcccctctatcttctttcgaccaaaaattt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446162 |
gaatcctccttgcccctctatcttctttcgaccaaaaattt |
35446202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 104 - 213
Target Start/End: Complemental strand, 35682096 - 35681987
Alignment:
| Q |
104 |
acttttggttctcctttagttggaaatcacatattttctcatgctacaaggagagaaaattggactgaccacttcttccattttgtgatgagatatgaca |
203 |
Q |
| |
|
|||||||||||||| || ||||| ||||| ||||| ||||||||| ||| |||||||| ||| || | || ||| | || ||||| ||| |||||||| |
|
|
| T |
35682096 |
acttttggttctcccttggttggtaatcatatattctctcatgcttcaaacagagaaaaatggtctcatcatttcatacactttgtcatgcaatatgaca |
35681997 |
T |
 |
| Q |
204 |
tagtgccaag |
213 |
Q |
| |
|
| |||||||| |
|
|
| T |
35681996 |
ttgtgccaag |
35681987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University