View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_11 (Length: 362)
Name: NF10041_high_11
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 359
Target Start/End: Original strand, 47539273 - 47539614
Alignment:
| Q |
18 |
ttttgcccccatcattataaataaataaattaaaccaagaacacaattctaatttatagtannnnnnnnacaatatcctttaattaattagaatagcaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
47539273 |
ttttgcccccatcattataaataaataaattaaaccaagaacacaattctaatttatagtattttttttacaatattctttaattaattagaatagcaca |
47539372 |
T |
 |
| Q |
118 |
ttttgatacaaaaatatttgatannnnnnnactaatttgatttgtttacaaaaataggttttacggctatatatttttacccatcaatataaaaatgcta |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47539373 |
ttttgatacaaaaatatttgatatttttttactaatttgatttgtttacaaaaataggttttacagctatatatttttacccatcaatataaaaatgcta |
47539472 |
T |
 |
| Q |
218 |
atatggcccctttcaattcctaatttctttttccagtattttgtcttctttttctcgctccagtttctgcacgtgaggctctagttcaccttgcatgtaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47539473 |
atatggcccctttcaattcctaatttctttttccagtattttgtcttctttttctcgctccagtttctgcacgtgaggctctagttcaccttgcatgtaa |
47539572 |
T |
 |
| Q |
318 |
gcctacttctcttcttattgcttatacttggcctatgcttct |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
47539573 |
gcctacttctcttcttattgcttatacttggcttatgtttct |
47539614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University