View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_17 (Length: 303)
Name: NF10041_high_17
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 296
Target Start/End: Complemental strand, 31553479 - 31553202
Alignment:
| Q |
19 |
ttgatacaaaataaagatctagcaatagcagtgacaaaaattatttgggtctggttttttatatctaagatgtttgcaaaagcctcctttttcatggccg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553479 |
ttgatacaaaataaagatctagcaataacagtgacaaaaattatttgggtctggttttttatatctaagatgtttgcaaaagcctcctttttcatggccg |
31553380 |
T |
 |
| Q |
119 |
gcgtgtttgcaaagacaatcgcaacaagcatcatgcatgcctggaacacagggtccaacatagttgtcgtcgcatattttcaaatccgccccatacattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553379 |
gcgtgtttgcaaagacaatcgcaacaagcatcatgcatgcctggaacacagggtccaacatagttgtcgtcgcatattttcaaatccgccccatacattg |
31553280 |
T |
 |
| Q |
219 |
tagcgggcgggcattgaggtggcggccaagtcactccagccggacatcgagcaccatcttgaccaatcactttctgtg |
296 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553279 |
tatcgggcgggcattgaggtggcggccaagtcactccagccggacatcgagcaccatcttgaccaatcactttctgtg |
31553202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University