View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_39 (Length: 229)
Name: NF10041_high_39
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10041_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 54013528 - 54013752
Alignment:
Q |
1 |
caaatgggtgatttttgtaaagaggtaagacgggtgtatatataactc--gagtcggtaaaatatttattttattattcgatttaaatacgtgaaaatga |
98 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54013528 |
caaatgagtgatttttgtaaagaggtaagacgggtgtatatataactcttgagtcagtaaaatatttattttattattcgatttaaatacgtgaaaatga |
54013627 |
T |
 |
Q |
99 |
tttgttaatttgaaacagaatcataacaatgatattttgttaattatcaattattatagtgcgggtaaccatgtagatacaagtaacaatgatttcgaaa |
198 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
54013628 |
tttgttaatttgagacagaatcataacaatgatattttgttaattatcaattattatagtgcaggtaaccatgtagatacaagtaacaatgatttcgaaa |
54013727 |
T |
 |
Q |
199 |
ctatgagaatgctaattgggttgat |
223 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
54013728 |
ctatgagaatgctaattgggttgat |
54013752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University