View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_43 (Length: 228)
Name: NF10041_high_43
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_high_43 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 3125645 - 3125851
Alignment:
| Q |
6 |
atttggctatttttgtaaatcagtgtcgggctcattcaaaacttctattttgttgcttcgcaaagtcgatgtgaaaatgctactgggacaaaacgaaaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3125645 |
atttggctatttttgtaaatcagtgtcgggctcattcaaaacttctattttgttgcttcgcaaagtcaatgtgaaaatgctactgggacaaaacgaaaga |
3125744 |
T |
 |
| Q |
106 |
atatcattaatcaattctagaggcaatcaattctattagcaatatctaaacatataaacatcaattttacgtctttgaaatcaattttatcttctccgaa |
205 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3125745 |
atatcatt----------------aatcaattctattagaaatatctaaacatatcaacatcaattttacgtctttgaaatcaattttatcttctccgaa |
3125828 |
T |
 |
| Q |
206 |
gtggaactaaacatacactatat |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3125829 |
gtggaactaaacatacactatat |
3125851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University