View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_44 (Length: 225)
Name: NF10041_high_44
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_high_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 52676871 - 52677072
Alignment:
| Q |
1 |
aagaagttggtgatttgagaaggaacttattcccaacgccnnnnnnnnnnnnngttggaagcacttttgaaggtgcacctagagagcaacaagctttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52676871 |
aagaagttggtgatttgagaaggaacttattcccaacgcctttttcgttttttgttggaagcacttttgaaggtgcacctagagagcaacaagctttgct |
52676970 |
T |
|
| Q |
101 |
ggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaacacgcttaattatctatctgctgcttctgccgttaaagatgttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52676971 |
ggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaatacgcttaattatctatctgctgcttctgccgttaaagatgttttt |
52677070 |
T |
|
| Q |
201 |
cc |
202 |
Q |
| |
|
|| |
|
|
| T |
52677071 |
cc |
52677072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University