View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_45 (Length: 224)
Name: NF10041_high_45
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 30586822 - 30587012
Alignment:
| Q |
19 |
gtcacagtacgatacaacaggcttggtgcaagctatctgtgaatcttatgagaagtaggtgagccactgcaatttgcaggtggcagatgctaacgctcgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
30586822 |
gtcacagtacgatacaacaggcttggtgcaagctatctgtgaatcttatgagaagtaggtgagccactgcaatttgccggtggcagatgctaacactcgg |
30586921 |
T |
|
| Q |
119 |
tatttccactttttgtaatcaagaataatagcatactgagaatttttcttctgtaccataccgcttatcaagatttctcttctcatctgtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30586922 |
tatttccactttttgtaatcaagaataatagcatactgagaatttttcttctgtaccataccgcttatcaagatttctcttctcatctgtg |
30587012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University