View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_high_46 (Length: 206)
Name: NF10041_high_46
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10041_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 130 - 190
Target Start/End: Complemental strand, 40378762 - 40378702
Alignment:
Q |
130 |
atcggatcttgtaattgcatgcatatcgccttcaattgattcaccctttaaccattcaatt |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40378762 |
atcggatcttgtaattgcatgcatatcgccttcaattgattcaccctttaaccattcaatt |
40378702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 40378878 - 40378839
Alignment:
Q |
14 |
caaagggttaggttttcggcaatctcctccaaggtaccaa |
53 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
40378878 |
caaagtgttaggttttcggcaatctcctccaaggtaccaa |
40378839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University