View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_26 (Length: 359)
Name: NF10041_low_26
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 9 - 343
Target Start/End: Complemental strand, 32861106 - 32860772
Alignment:
| Q |
9 |
tggtgttggttaaattatagccttctcatcaacatggtgtcattgagccgcaatcagaaacttgtttatgctacttcggtcccttcccagtcattgagaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861106 |
tggtgttggttaaattatagccttctcgtcaacatggtgtcactgagccgtaatcagaaacttgtttatgctacttcggtcccttcccagtcattgagaa |
32861007 |
T |
|
| Q |
109 |
aatgggatcagttacatataaattgttgctgccatcagctgctaaaatacatctgtgtttttcgcattttcttattaaaacctttgttaacaagtgagca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861006 |
aatgggatcagttacatataaattgttgctgccatcagctgctaaaatacatctgtgtttttcgcattttcttattaaaacctttgttaacaagtgagca |
32860907 |
T |
|
| Q |
209 |
aggtccaatactagaggcaaaatccattctacaatcttgcattttacttcaacaaggtcagccagtaccgcaagtactggttcactgtgaaggggtttca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32860906 |
aggtccaatactagaggcaaaatccattctacaatcttgcattttacttcaacaaggtcaggcagtaccgcaagtactcgttcactgtgaaggggtttca |
32860807 |
T |
|
| Q |
309 |
agtgatgatgctactttggaagattggcttcaact |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860806 |
agtgatgatgctactttggaagattggcttcaact |
32860772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University