View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_34 (Length: 334)
Name: NF10041_low_34
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10041_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 33918315 - 33918002
Alignment:
Q |
16 |
cagattttggaaaaatgttctttgcaggagacagtgctggtgcaaacattgcacatcacatggctattcgtgttggaactcaagggcttcaagggattaa |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33918315 |
cagattttggaaaaatgttctttgcaggagacagtgctggtgcaaacattgcaaatcacatggctattcgtgttggaactcaagggcttcaagggattaa |
33918216 |
T |
 |
Q |
116 |
ccttgaagggattgttttggttcatacattcttttggggtgttgaaagggttggatctgaggctactgagaaatctgaacacttatctttggctgataat |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33918215 |
ccttgaagggattgttttggttcatacattcttttggggtgttgaaagggttggatctgaggctactgagaaatctgaacacttatctttggctgataat |
33918116 |
T |
 |
Q |
216 |
ttatggaggtttgtttgtccaacaagtttgggatccgatgacccgtttttgaatccgggtaaggataagaatttggggaggttgggttgtaagagagttt |
315 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33918115 |
ttatggaggtttgtttgtccaacaagttcgggatccgatgacccgtttttgaatccgggtaaggataagaatttggggaggttgggttgtaagagagttt |
33918016 |
T |
 |
Q |
316 |
tggtctgtgctgct |
329 |
Q |
|
|
|||| |||| |||| |
|
|
T |
33918015 |
tggtttgtgttgct |
33918002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 19642792 - 19642479
Alignment:
Q |
16 |
cagattttggaaaaatgttctttgcaggagacagtgctggtgcaaacattgcacatcacatggctattcgtgttggaactcaagggcttcaagggattaa |
115 |
Q |
|
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
19642792 |
cagattttggaaaagttttctttgcaggagacagtgctggtgcaaacattgcacaccacatggctattcgtgttggaactgaagggcttcaagggattaa |
19642693 |
T |
 |
Q |
116 |
ccttgaagggattgttttggttcatacattcttttggggtgttgaaagggttggatctgaggctactgagaaatctgaac---acttatctttggctgat |
212 |
Q |
|
|
| ||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||| |||||||| |||||| | |||||||| | ||| |
|
|
T |
19642692 |
cattgaagggattgttttggttcatgcattcttttggggtgtggaaagagttggatctgagg---ctgagaaacctgaacaatatttatcttttgtggat |
19642596 |
T |
 |
Q |
213 |
aatttatggaggtttgtttgtccaacaagtttgggatccgatgacccgtttttgaatccgggtaaggataagaatttggggaggttgggttgtaagagag |
312 |
Q |
|
|
||||||||| | ||||||||||||||||||| |||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
19642595 |
aatttatggcgatttgtttgtccaacaagttcgggacccgatgacatgttattgaatccgggtaaggataagaatttggggaggttgggttgtaagagtg |
19642496 |
T |
 |
Q |
313 |
ttttggtctgtgctgct |
329 |
Q |
|
|
||||||| |||| |||| |
|
|
T |
19642495 |
ttttggtttgtgttgct |
19642479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University