View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_36 (Length: 324)
Name: NF10041_low_36
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10041_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 12 - 308
Target Start/End: Original strand, 155324 - 155620
Alignment:
Q |
12 |
ttggtgttgaggtctcatcttttggtgcttctcaagcacaagacattgttcactagggagagggtgatgacagggtctactatagtgaacaaggttaagg |
111 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
155324 |
ttggtgttgaggtctcatctttgggtgcttctcaagcacaagacattgttcactagggagagggtgatgacagggtctactattgtgaacaaggttaagg |
155423 |
T |
 |
Q |
112 |
caagggattttgcaaaaccaggtttgggaagagggataagggtggaggatttggacatttcacaagaggagatggaaatgtatgttgatcttcatccaat |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
155424 |
caagggattttgcaaaaccaggtttgggaagagggataagggtggaggatttggacatttcacaagaggagatggaaatgtatgttgatcttcatccaat |
155523 |
T |
 |
Q |
212 |
cacaaatacttctccatatactgttgttgaaacaatgtctcttgcaaaagctgctcttctgtttcgggagcttggactcaggcatttgctagttgtg |
308 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
155524 |
cacaaatacttctccatatactgttgttgaaacaatgtctcttgcaaaagctgctcttctgtttcgggagcttggactcaggcatttgctagttgtg |
155620 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 271
Target Start/End: Complemental strand, 24328867 - 24328780
Alignment:
Q |
184 |
tggaaatgtatgttgatcttcatccaatcacaaatacttctccatatactgttgttgaaacaatgtctcttgcaaaagctgctcttct |
271 |
Q |
|
|
|||| ||||||||||||||||||||||| || ||||| || || || ||||| ||||| || ||||| ||||| ||||| ||| |||| |
|
|
T |
24328867 |
tggatatgtatgttgatcttcatccaataactaatacatcgccgtacactgtagttgagactatgtcacttgctaaagccgctattct |
24328780 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University