View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_48 (Length: 282)
Name: NF10041_low_48
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 264
Target Start/End: Original strand, 4533624 - 4533879
Alignment:
| Q |
8 |
ttggtgttgatattgtttatatttatacttcatccgtatcaaaataattgtgtgtattttttctctgtttcaaaataattgttagtttcgaatactaaag |
107 |
Q |
| |
|
|||||||||||||| || |||| |||||||||| || |||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4533624 |
ttggtgttgatattatt-atatctatacttcattagtctcaaaataattgtgtgtattttttttatgtttcaaaataattgtcagtttcgaatactaaag |
4533722 |
T |
 |
| Q |
108 |
acatcatttacatcatttattcctttaatagatgtagaccttgattgagaatatttcaaacgaaaatcggagggattgattctctcaaaaaagtttctaa |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||| | | |
|
|
| T |
4533723 |
acatcatttacatcatttattcttttaatagatgtagaccttgattgagaatatttcaaacgaaaatcgggagcattaattctctcaaaaaagtttttca |
4533822 |
T |
 |
| Q |
208 |
tgtttcttgatctctacctttaaaattcaattttttcaattaagattttaatagatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4533823 |
tgtttcttgatctctacctttaaaattcatccttttcgattaagattttaatagatt |
4533879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University