View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_51 (Length: 255)
Name: NF10041_low_51
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 17357854 - 17358098
Alignment:
| Q |
1 |
tgtaaataaaataaacgtgattgaaaagagggaccacctattttgttgagtagagattaattattaacaaagtcgatagttctcacaataacatcgttac |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17357854 |
tgtaaataaaataaacgtgattgagaagaggaaccacctattttgttgactagagattaattattaacaaagtcgatagttctcacaacaacatcgttac |
17357953 |
T |
 |
| Q |
101 |
caaaaacaaacaaaaattacgctcaaccgacaaatcaatgttagtagtag-ttttttgtatgttaataatttcaaatcaatgtctaaatattgaacattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17357954 |
caaaaacaaacaaaaattacgctcaaccgacaaatcaatgttagtagtagtttttttgtatgttaataatttcaaatcaatgtctaaatattgaacattt |
17358053 |
T |
 |
| Q |
200 |
ttaatttgatcagaaagacaaagcttccatactgataacaccaaa |
244 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17358054 |
taaatttgatcagaaagacaaagcttccatactgataacagcaaa |
17358098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University