View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_57 (Length: 249)
Name: NF10041_low_57
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_57 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 35603469 - 35603227
Alignment:
| Q |
7 |
ttggtgttgctggtaatattggtagccaaaaatatccaagtctcccttccatggtggggcatattaagaagaccacttttgcttacctaaaacgtagaat |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35603469 |
ttggtgttgttggtaatattggtagccaaaaatatccaagtctcccttccatggtggggcatattaagaagaccactttcgcttacctaaaacgtagaat |
35603370 |
T |
 |
| Q |
107 |
ttgtaaataagtgtcaattttgaagtgttggattctttctcgcgttggaaagaaaatcttaattaaatctgttactcaggaatcatgccgtatatgtatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603369 |
ttgtaaataagtgtcaattttgaagtgttggattctttctcgcgttggaaagaaaatcttaattaaatctgttactcaggaatcatgccgtatatgtatg |
35603270 |
T |
 |
| Q |
207 |
gatcttctcaaggaaccctatatcatgcaaagtatcactcaca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603269 |
gatcttctcaaggaaccctatatcatgcaaagtatcactcaca |
35603227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University