View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_58 (Length: 249)
Name: NF10041_low_58
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 42777925 - 42778171
Alignment:
| Q |
1 |
ataaatcgtcaacgttgtaaagatagtagaagtccttcttgtgaataaggaatgatgtgatttggattgaatgaaacaaattgagattagaaaactagat |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42777925 |
ataaaccgtcaacgttgtaaagatagtagaagttcttcttatgaataaggaatgatgtgatttggattgaatgaaacaaattgagattagaaaactagat |
42778024 |
T |
 |
| Q |
101 |
ggttaggagaaccattggtgacttgcttgttttaaaccataagagatttcagtaatctgcaaacttgactaggatttgaggaagtcacaccaagaggaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42778025 |
ggttaggagaaccattggtgacttgcttgttttaaaccataagagatttcagtaatctgcaaacttgaataggatttgaggaagtcacaccaagaggaag |
42778124 |
T |
 |
| Q |
201 |
ctttatataaacctcttcattattgttgtgtgtatccctttgctact |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42778125 |
ctttatataaacctcttcattattgttgtgtgtatccctttgctact |
42778171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University