View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_59 (Length: 249)
Name: NF10041_low_59
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 31413275 - 31413529
Alignment:
| Q |
1 |
tatgttccaggcgcccaaatagattgatctaacggccataatattttggcgtctaaaaatccagatttagggttttgaaggattagttgcagtgttaaca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31413275 |
tatgttccaggcacccaaatagattgatctaacggccacaatattttggcgcctaaaaatccaaatttagggttttggaggattagttgcagtgttaaca |
31413374 |
T |
 |
| Q |
101 |
aagattagaaataagtatg-------------------attatttatgtaatttacacaaatctaaaatcatttatattattgagacccatcattaaggg |
181 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
31413375 |
aagattagaaataagtatgagtatgatgatatgatatgattatttatgtaatttacacaaatctaaaatcatttatattattgagacccagcgttaaggg |
31413474 |
T |
 |
| Q |
182 |
cttatgcgctttcatttaatatggttattgaaacaatgcactatcacacgcctct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31413475 |
cttatgcgctttcatttaatatggttattgaaacaatgcaccttcacacgcctct |
31413529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 38014460 - 38014390
Alignment:
| Q |
1 |
tatgttccaggcgcccaaatagattgatctaacggccataatattttggcgtctaaaaatccagatttagg |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| || |||||| |
|
|
| T |
38014460 |
tatgttccaggcgcccaaatagattgatctaacggccataatagtttggcgcctaaaaatctaggtttagg |
38014390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University