View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_60 (Length: 249)
Name: NF10041_low_60
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_60 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 12874853 - 12875094
Alignment:
| Q |
8 |
agcagagacctcgaaatatgacaaaagtcatatgaccagtcattcccgaccatgttatgaagcaaattagaaagtaccccctttgatcaattactacttt |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12874853 |
agcaaagacctcgaaatatgacaaaagtcatatgaccagtcattcccgaccatgttatgaagcaaattagaaagtaccccctttggtcaattactacttt |
12874952 |
T |
|
| Q |
108 |
tatgaatttttacatatttgtattttagaatatgaataacaaaaaagttatttttatacatccgaattagactctgaaagcctcctctaaatattttgaa |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12874953 |
tatgattttttacatatttgtattttagaatatgaacaacaaaaaagttatttttatacatccgaattagactctgaaagccgcctctaaatattttgaa |
12875052 |
T |
|
| Q |
208 |
acccttttgtgcaaaaatagaatttcatacttttttcctatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12875053 |
acccttttgtgcaaaaatagaatttcatacttttttcctatc |
12875094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University