View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_62 (Length: 248)
Name: NF10041_low_62
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 31 - 150
Target Start/End: Original strand, 10279164 - 10279283
Alignment:
| Q |
31 |
cacattgttctgaagtaactttaatatttttactagtgataatcaataagtagaacatgattgttaatgcttacaaaattaatacacacatagacatata |
130 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
10279164 |
cacatttttctgaagtaactttaatatttttactagtgataatcaataagtagaacatgattgttaatgctaacaaagttaatacacacatagacatata |
10279263 |
T |
 |
| Q |
131 |
caaataaaatttatcaatta |
150 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10279264 |
caaataaaatttatcaatta |
10279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University