View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_70 (Length: 241)
Name: NF10041_low_70
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 5 - 204
Target Start/End: Complemental strand, 35603094 - 35602895
Alignment:
| Q |
5 |
tgagaaacttctggaaacccatatgcacactttctttctttgtcataaggctttgaattgttttgtaaaaatgggattgataatatcgttcggtagctac |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603094 |
tgagaaacttgtggaaacccatatgcacactttctttctttgtcataaggctttgaattgttttgtaaaaatgggattgataatatcgttcggtagctac |
35602995 |
T |
 |
| Q |
105 |
ttctcagtgttaacattttctctgatatgctttttgatttgcttgataggttatcatcccaacaacaaccattgactgtgatgatttcatggagtttgtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35602994 |
ttctcagtgttaacattttctctgatatgctttttgatttgcttgataggttatcatcccaaccacaaccattgactgtgatgatttcatggagtttgtg |
35602895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University