View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10041_low_71 (Length: 241)
Name: NF10041_low_71
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10041_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 20 - 225
Target Start/End: Original strand, 33645418 - 33645622
Alignment:
| Q |
20 |
tgtaatacatggctccatgtattgactacaatagtggctccaagagctattgttaatccgatgcgatgagtattgttgtagtttatttgtactttgagtt |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33645418 |
tgtaatatatggctccatgtattgactacaatagtggctccaagagctattgttaatccgatgcgatgagtattgttgtag-ttatttgtactttgagtt |
33645516 |
T |
 |
| Q |
120 |
ctc-nnnnnnnnggttacaataggaaaatattttgtactttgagttccaacaaatgcatgcttctgatccatttaataggtaatataaacttatctagtg |
218 |
Q |
| |
|
||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33645517 |
ctcttttttttttgttacaataggaaaata-tttgtactttgagttccaacaaatgcatgcttctgatccatttaataggtaatataaacttatctagtg |
33645615 |
T |
 |
| Q |
219 |
ttccttc |
225 |
Q |
| |
|
||||||| |
|
|
| T |
33645616 |
ttccttc |
33645622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University